ID: 964157203

View in Genome Browser
Species Human (GRCh38)
Location 3:153600570-153600592
Sequence CCCCTGGGCTGAAGGAATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964157203_964157209 -10 Left 964157203 3:153600570-153600592 CCAGCATTCCTTCAGCCCAGGGG No data
Right 964157209 3:153600583-153600605 AGCCCAGGGGCAAAGAGTGGGGG No data
964157203_964157212 9 Left 964157203 3:153600570-153600592 CCAGCATTCCTTCAGCCCAGGGG No data
Right 964157212 3:153600602-153600624 GGGGAAACTTCTACTCAGCCTGG No data
964157203_964157213 19 Left 964157203 3:153600570-153600592 CCAGCATTCCTTCAGCCCAGGGG No data
Right 964157213 3:153600612-153600634 CTACTCAGCCTGGTAAATACTGG No data
964157203_964157214 20 Left 964157203 3:153600570-153600592 CCAGCATTCCTTCAGCCCAGGGG No data
Right 964157214 3:153600613-153600635 TACTCAGCCTGGTAAATACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964157203 Original CRISPR CCCCTGGGCTGAAGGAATGC TGG (reversed) Intergenic
No off target data available for this crispr