ID: 964157205

View in Genome Browser
Species Human (GRCh38)
Location 3:153600578-153600600
Sequence ACTCTTTGCCCCTGGGCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964157205_964157213 11 Left 964157205 3:153600578-153600600 CCTTCAGCCCAGGGGCAAAGAGT No data
Right 964157213 3:153600612-153600634 CTACTCAGCCTGGTAAATACTGG No data
964157205_964157212 1 Left 964157205 3:153600578-153600600 CCTTCAGCCCAGGGGCAAAGAGT No data
Right 964157212 3:153600602-153600624 GGGGAAACTTCTACTCAGCCTGG No data
964157205_964157214 12 Left 964157205 3:153600578-153600600 CCTTCAGCCCAGGGGCAAAGAGT No data
Right 964157214 3:153600613-153600635 TACTCAGCCTGGTAAATACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964157205 Original CRISPR ACTCTTTGCCCCTGGGCTGA AGG (reversed) Intergenic
No off target data available for this crispr