ID: 964157210

View in Genome Browser
Species Human (GRCh38)
Location 3:153600585-153600607
Sequence TTCCCCCACTCTTTGCCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964157210_964157214 5 Left 964157210 3:153600585-153600607 CCCAGGGGCAAAGAGTGGGGGAA No data
Right 964157214 3:153600613-153600635 TACTCAGCCTGGTAAATACTGGG No data
964157210_964157212 -6 Left 964157210 3:153600585-153600607 CCCAGGGGCAAAGAGTGGGGGAA No data
Right 964157212 3:153600602-153600624 GGGGAAACTTCTACTCAGCCTGG No data
964157210_964157216 29 Left 964157210 3:153600585-153600607 CCCAGGGGCAAAGAGTGGGGGAA No data
Right 964157216 3:153600637-153600659 GCTTCTCCATAGAAGAGACGCGG No data
964157210_964157217 30 Left 964157210 3:153600585-153600607 CCCAGGGGCAAAGAGTGGGGGAA No data
Right 964157217 3:153600638-153600660 CTTCTCCATAGAAGAGACGCGGG No data
964157210_964157213 4 Left 964157210 3:153600585-153600607 CCCAGGGGCAAAGAGTGGGGGAA No data
Right 964157213 3:153600612-153600634 CTACTCAGCCTGGTAAATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964157210 Original CRISPR TTCCCCCACTCTTTGCCCCT GGG (reversed) Intergenic
No off target data available for this crispr