ID: 964157212

View in Genome Browser
Species Human (GRCh38)
Location 3:153600602-153600624
Sequence GGGGAAACTTCTACTCAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964157211_964157212 -7 Left 964157211 3:153600586-153600608 CCAGGGGCAAAGAGTGGGGGAAA No data
Right 964157212 3:153600602-153600624 GGGGAAACTTCTACTCAGCCTGG No data
964157200_964157212 26 Left 964157200 3:153600553-153600575 CCTGGCTGCACAAAGTACCAGCA No data
Right 964157212 3:153600602-153600624 GGGGAAACTTCTACTCAGCCTGG No data
964157210_964157212 -6 Left 964157210 3:153600585-153600607 CCCAGGGGCAAAGAGTGGGGGAA No data
Right 964157212 3:153600602-153600624 GGGGAAACTTCTACTCAGCCTGG No data
964157203_964157212 9 Left 964157203 3:153600570-153600592 CCAGCATTCCTTCAGCCCAGGGG No data
Right 964157212 3:153600602-153600624 GGGGAAACTTCTACTCAGCCTGG No data
964157205_964157212 1 Left 964157205 3:153600578-153600600 CCTTCAGCCCAGGGGCAAAGAGT No data
Right 964157212 3:153600602-153600624 GGGGAAACTTCTACTCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964157212 Original CRISPR GGGGAAACTTCTACTCAGCC TGG Intergenic
No off target data available for this crispr