ID: 964157214

View in Genome Browser
Species Human (GRCh38)
Location 3:153600613-153600635
Sequence TACTCAGCCTGGTAAATACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964157210_964157214 5 Left 964157210 3:153600585-153600607 CCCAGGGGCAAAGAGTGGGGGAA No data
Right 964157214 3:153600613-153600635 TACTCAGCCTGGTAAATACTGGG No data
964157211_964157214 4 Left 964157211 3:153600586-153600608 CCAGGGGCAAAGAGTGGGGGAAA No data
Right 964157214 3:153600613-153600635 TACTCAGCCTGGTAAATACTGGG No data
964157203_964157214 20 Left 964157203 3:153600570-153600592 CCAGCATTCCTTCAGCCCAGGGG No data
Right 964157214 3:153600613-153600635 TACTCAGCCTGGTAAATACTGGG No data
964157205_964157214 12 Left 964157205 3:153600578-153600600 CCTTCAGCCCAGGGGCAAAGAGT No data
Right 964157214 3:153600613-153600635 TACTCAGCCTGGTAAATACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964157214 Original CRISPR TACTCAGCCTGGTAAATACT GGG Intergenic
No off target data available for this crispr