ID: 964164239

View in Genome Browser
Species Human (GRCh38)
Location 3:153682338-153682360
Sequence GTGGACACAAAGGTTGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964164239_964164242 -5 Left 964164239 3:153682338-153682360 CCAACCTCAACCTTTGTGTCCAC No data
Right 964164242 3:153682356-153682378 TCCACACTCCATAATTCTCTTGG No data
964164239_964164245 15 Left 964164239 3:153682338-153682360 CCAACCTCAACCTTTGTGTCCAC No data
Right 964164245 3:153682376-153682398 TGGTTGTGAGACAATGAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964164239 Original CRISPR GTGGACACAAAGGTTGAGGT TGG (reversed) Intergenic
No off target data available for this crispr