ID: 964164242

View in Genome Browser
Species Human (GRCh38)
Location 3:153682356-153682378
Sequence TCCACACTCCATAATTCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964164239_964164242 -5 Left 964164239 3:153682338-153682360 CCAACCTCAACCTTTGTGTCCAC No data
Right 964164242 3:153682356-153682378 TCCACACTCCATAATTCTCTTGG No data
964164240_964164242 -9 Left 964164240 3:153682342-153682364 CCTCAACCTTTGTGTCCACACTC No data
Right 964164242 3:153682356-153682378 TCCACACTCCATAATTCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964164242 Original CRISPR TCCACACTCCATAATTCTCT TGG Intergenic
No off target data available for this crispr