ID: 964164245

View in Genome Browser
Species Human (GRCh38)
Location 3:153682376-153682398
Sequence TGGTTGTGAGACAATGAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964164243_964164245 -4 Left 964164243 3:153682357-153682379 CCACACTCCATAATTCTCTTGGT No data
Right 964164245 3:153682376-153682398 TGGTTGTGAGACAATGAGCTTGG No data
964164240_964164245 11 Left 964164240 3:153682342-153682364 CCTCAACCTTTGTGTCCACACTC No data
Right 964164245 3:153682376-153682398 TGGTTGTGAGACAATGAGCTTGG No data
964164241_964164245 5 Left 964164241 3:153682348-153682370 CCTTTGTGTCCACACTCCATAAT No data
Right 964164245 3:153682376-153682398 TGGTTGTGAGACAATGAGCTTGG No data
964164239_964164245 15 Left 964164239 3:153682338-153682360 CCAACCTCAACCTTTGTGTCCAC No data
Right 964164245 3:153682376-153682398 TGGTTGTGAGACAATGAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964164245 Original CRISPR TGGTTGTGAGACAATGAGCT TGG Intergenic
No off target data available for this crispr