ID: 964175251

View in Genome Browser
Species Human (GRCh38)
Location 3:153820203-153820225
Sequence GTTTGTGATGGGAGTGGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964175251_964175262 18 Left 964175251 3:153820203-153820225 CCCACTCCACTCCCATCACAAAC No data
Right 964175262 3:153820244-153820266 CCACCCACCCAAGTGCAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964175251 Original CRISPR GTTTGTGATGGGAGTGGAGT GGG (reversed) Intergenic
No off target data available for this crispr