ID: 964176737

View in Genome Browser
Species Human (GRCh38)
Location 3:153832617-153832639
Sequence GGAGAACAGCACCAAGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964176731_964176737 7 Left 964176731 3:153832587-153832609 CCAGATTTTGTGAGAACTCACTC 0: 11
1: 270
2: 804
3: 1904
4: 2812
Right 964176737 3:153832617-153832639 GGAGAACAGCACCAAGGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964176737 Original CRISPR GGAGAACAGCACCAAGGGGA TGG Intergenic
No off target data available for this crispr