ID: 964177130

View in Genome Browser
Species Human (GRCh38)
Location 3:153837590-153837612
Sequence GTGTAGTATTGTTAACTACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964177128_964177130 15 Left 964177128 3:153837552-153837574 CCTTAGCACGAAACCATGAGGTC No data
Right 964177130 3:153837590-153837612 GTGTAGTATTGTTAACTACTAGG No data
964177127_964177130 16 Left 964177127 3:153837551-153837573 CCCTTAGCACGAAACCATGAGGT No data
Right 964177130 3:153837590-153837612 GTGTAGTATTGTTAACTACTAGG No data
964177129_964177130 2 Left 964177129 3:153837565-153837587 CCATGAGGTCTGAAAACTGAATC No data
Right 964177130 3:153837590-153837612 GTGTAGTATTGTTAACTACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964177130 Original CRISPR GTGTAGTATTGTTAACTACT AGG Intergenic
No off target data available for this crispr