ID: 964181378

View in Genome Browser
Species Human (GRCh38)
Location 3:153891111-153891133
Sequence CAAAATAAGTAGATGAGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964181378_964181381 20 Left 964181378 3:153891111-153891133 CCAGACCTCATCTACTTATTTTG No data
Right 964181381 3:153891154-153891176 TTCAGTGATTTTGTTGCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964181378 Original CRISPR CAAAATAAGTAGATGAGGTC TGG (reversed) Intergenic
No off target data available for this crispr