ID: 964181725

View in Genome Browser
Species Human (GRCh38)
Location 3:153895612-153895634
Sequence CAGAATAATGAGAATGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964181725_964181728 12 Left 964181725 3:153895612-153895634 CCTTCCACATTCTCATTATTCTG No data
Right 964181728 3:153895647-153895669 CAAAATTGAGACTTCATCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964181725 Original CRISPR CAGAATAATGAGAATGTGGA AGG (reversed) Intergenic
No off target data available for this crispr