ID: 964189064

View in Genome Browser
Species Human (GRCh38)
Location 3:153980830-153980852
Sequence CTCACAGGAAGCCACACTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964189060_964189064 10 Left 964189060 3:153980797-153980819 CCCAGAAGAGAGACAACAATCGC No data
Right 964189064 3:153980830-153980852 CTCACAGGAAGCCACACTGATGG No data
964189059_964189064 24 Left 964189059 3:153980783-153980805 CCTGGGCAGCTAGACCCAGAAGA No data
Right 964189064 3:153980830-153980852 CTCACAGGAAGCCACACTGATGG No data
964189061_964189064 9 Left 964189061 3:153980798-153980820 CCAGAAGAGAGACAACAATCGCT No data
Right 964189064 3:153980830-153980852 CTCACAGGAAGCCACACTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964189064 Original CRISPR CTCACAGGAAGCCACACTGA TGG Intergenic
No off target data available for this crispr