ID: 964195533

View in Genome Browser
Species Human (GRCh38)
Location 3:154059831-154059853
Sequence GGGCTCTTCCTCTTTCCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964195533_964195539 4 Left 964195533 3:154059831-154059853 CCAGAAGGAAAGAGGAAGAGCCC No data
Right 964195539 3:154059858-154059880 CCTACAGCACACATCAGTGCAGG No data
964195533_964195542 22 Left 964195533 3:154059831-154059853 CCAGAAGGAAAGAGGAAGAGCCC No data
Right 964195542 3:154059876-154059898 GCAGGGCCCACTGTAAGGTGAGG No data
964195533_964195540 5 Left 964195533 3:154059831-154059853 CCAGAAGGAAAGAGGAAGAGCCC No data
Right 964195540 3:154059859-154059881 CTACAGCACACATCAGTGCAGGG No data
964195533_964195545 30 Left 964195533 3:154059831-154059853 CCAGAAGGAAAGAGGAAGAGCCC No data
Right 964195545 3:154059884-154059906 CACTGTAAGGTGAGGAGCTCAGG No data
964195533_964195541 17 Left 964195533 3:154059831-154059853 CCAGAAGGAAAGAGGAAGAGCCC No data
Right 964195541 3:154059871-154059893 TCAGTGCAGGGCCCACTGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964195533 Original CRISPR GGGCTCTTCCTCTTTCCTTC TGG (reversed) Intergenic
No off target data available for this crispr