ID: 964195651

View in Genome Browser
Species Human (GRCh38)
Location 3:154061485-154061507
Sequence CAAAGTGGATACTTTGATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964195651_964195653 -8 Left 964195651 3:154061485-154061507 CCATGATCAAAGTATCCACTTTG No data
Right 964195653 3:154061500-154061522 CCACTTTGAAAACAACAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964195651 Original CRISPR CAAAGTGGATACTTTGATCA TGG (reversed) Intergenic
No off target data available for this crispr