ID: 964198366

View in Genome Browser
Species Human (GRCh38)
Location 3:154089757-154089779
Sequence TGGTTTAAAAAAATGAAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964198363_964198366 27 Left 964198363 3:154089707-154089729 CCAGTGTATAAATGTCGACAGTC No data
Right 964198366 3:154089757-154089779 TGGTTTAAAAAAATGAAGCATGG No data
964198365_964198366 -6 Left 964198365 3:154089740-154089762 CCTATAAAATGCTTTATTGGTTT No data
Right 964198366 3:154089757-154089779 TGGTTTAAAAAAATGAAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964198366 Original CRISPR TGGTTTAAAAAAATGAAGCA TGG Intergenic
No off target data available for this crispr