ID: 964200048

View in Genome Browser
Species Human (GRCh38)
Location 3:154108846-154108868
Sequence CCCATGCCTCCATTTCTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964200048_964200053 18 Left 964200048 3:154108846-154108868 CCACAAAGAAATGGAGGCATGGG No data
Right 964200053 3:154108887-154108909 GTTGAGTGCAAGTTCTGGTGTGG No data
964200048_964200052 13 Left 964200048 3:154108846-154108868 CCACAAAGAAATGGAGGCATGGG No data
Right 964200052 3:154108882-154108904 CCTGAGTTGAGTGCAAGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964200048 Original CRISPR CCCATGCCTCCATTTCTTTG TGG (reversed) Intergenic
No off target data available for this crispr