ID: 964201305

View in Genome Browser
Species Human (GRCh38)
Location 3:154121752-154121774
Sequence GCGGCAGCCCAGATTTCTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 1, 2: 0, 3: 13, 4: 109}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964201305 Original CRISPR GCGGCAGCCCAGATTTCTGC CGG Intronic
900630188 1:3630981-3631003 GTGGCCGCCCAGCTGTCTGCAGG + Exonic
902369389 1:15996144-15996166 ATGGCTGCCCAGATATCTGCTGG + Intergenic
904375823 1:30081859-30081881 GTAGCAGCCCAGAGGTCTGCAGG - Intergenic
906658555 1:47566160-47566182 GAGGCAGCCTAGATCTCTGAGGG - Intergenic
918462058 1:184786971-184786993 GTGGTATCCCAGATTTCAGCAGG - Intergenic
918516549 1:185369798-185369820 GCGGTAGCCCAGATCTATGCAGG - Intergenic
923287897 1:232514582-232514604 GCAGCAGCACAGATTTCTAGGGG - Exonic
1063725764 10:8635761-8635783 CAGGCAGCCCAGATTTATGAAGG - Intergenic
1067966640 10:50920877-50920899 CCAGCAGCACAGATTTCTGAAGG + Intergenic
1070349222 10:75575915-75575937 ACGGCCGCCCAGTTTTGTGCTGG - Intronic
1072764323 10:98083509-98083531 GCTGGAACCCAGATATCTGCTGG - Intergenic
1073871745 10:107872471-107872493 GAGGCACCCCAATTTTCTGCGGG + Intergenic
1078090040 11:8259428-8259450 GCGGCAGCCCTCCTTTCTGCTGG - Intronic
1078744920 11:14103416-14103438 CCTGCAACCCAGATGTCTGCAGG - Intronic
1081915811 11:46729458-46729480 GGGGCAGCCCAGTGTCCTGCAGG + Exonic
1081989513 11:47330252-47330274 ATGGCAGCCCAGCTCTCTGCAGG - Intergenic
1085705978 11:78787068-78787090 TCGGCAGCACAGATCTCTGTGGG + Exonic
1089141095 11:116285045-116285067 GGGGCAGTCCAGATTTGAGCTGG - Intergenic
1089616711 11:119698963-119698985 GAGGCTGCCCATTTTTCTGCAGG - Intronic
1097997832 12:65909247-65909269 GCGCCAGCACAAATTTCTGCTGG + Intronic
1101738364 12:107480840-107480862 GGTGAAGCCCAGAGTTCTGCAGG + Intronic
1103893004 12:124254062-124254084 GCGGTAGCCCAGATTTCATGGGG + Intronic
1104978501 12:132562542-132562564 CCTGCAGCCCAGGCTTCTGCAGG - Intronic
1108845635 13:54676596-54676618 CTGGCAGCCCAGGTTCCTGCCGG - Intergenic
1111950503 13:94705591-94705613 AGGGCACCCCAGATCTCTGCGGG + Intergenic
1113414576 13:110118210-110118232 GGGGCCTCCCACATTTCTGCTGG - Intergenic
1115520813 14:34231477-34231499 GCAGCTGCCCAGATTCCTCCTGG + Intronic
1120384169 14:83822972-83822994 GCTGCAGCCCAGATTGCTCTAGG + Intergenic
1122254098 14:100464062-100464084 GGGGCATCCCAGGGTTCTGCAGG - Intronic
1123034240 14:105465414-105465436 GCGGCCGCCCTGTCTTCTGCGGG + Intronic
1129075806 15:72994984-72995006 GCGGCAGCCCAGAAACCAGCAGG - Intergenic
1129274208 15:74434522-74434544 GAGGCAGCCCAGAAGGCTGCTGG - Intergenic
1132717989 16:1301545-1301567 CCCACACCCCAGATTTCTGCAGG + Intergenic
1137695556 16:50459848-50459870 GCGGCAGGCCAGCTTCCTGAAGG - Intergenic
1149309535 17:55380635-55380657 GCGGCAGCCCAGATAGATGTTGG + Intergenic
1159524445 18:69569169-69569191 CTGGCAGCCTAGATTTCTCCTGG - Intronic
1160153547 18:76413634-76413656 GTGGCAGCCCAGATATTTGGGGG - Intronic
1162079178 19:8208767-8208789 GGGGAGGCCCAGATTTCTCCAGG - Intronic
1163432465 19:17276495-17276517 CCGGAAGCTCAGTTTTCTGCTGG - Exonic
1164564896 19:29318731-29318753 GAGGGAAGCCAGATTTCTGCTGG - Intergenic
1166328788 19:42067019-42067041 TAGGCACCCCAGCTTTCTGCAGG + Intronic
1166338655 19:42123772-42123794 GCTGAAGCCCAGATTTGTCCTGG - Intronic
927117114 2:19916292-19916314 ACGGCCGCCCAGTTTTGTGCTGG - Intronic
933951987 2:87338856-87338878 GAGCCTGCCCAGGTTTCTGCTGG - Intergenic
934216914 2:90039302-90039324 GCGCCAGGCCAGGTTTCTGCTGG - Intergenic
934236229 2:90235191-90235213 GAGCCTGCCCAGGTTTCTGCTGG - Intergenic
934619036 2:95792922-95792944 GAGGGAGCCCAGATTTCTCATGG + Intergenic
934641855 2:96031635-96031657 GAGGGAGCCCAGATTTCTCATGG - Intronic
935831416 2:107004830-107004852 GAGGCAGCCCTGAATTATGCCGG + Intergenic
937225084 2:120364083-120364105 GCGGGAGCCCAGTGTTCTGGGGG + Intergenic
937508546 2:122565748-122565770 GAGTCAGCCAAGCTTTCTGCAGG - Intergenic
937775510 2:125770911-125770933 GAGGCAGCTCAGGTTCCTGCAGG + Intergenic
938295538 2:130176553-130176575 GCAGCAGCCCAGCTTTCTACTGG - Exonic
938461087 2:131497272-131497294 GCAGCAGCCCAGCTTTCTACTGG + Intergenic
941902958 2:170695175-170695197 CCGGCAGCTCAGGTTTCTGCTGG + Intergenic
943763069 2:191631071-191631093 ACGGCAGCCTAGACTTCTCCAGG + Intergenic
945037635 2:205717571-205717593 GTGGCAGCCCAGGCTGCTGCAGG + Intronic
1171419731 20:25009946-25009968 GAGGCAGCTGAGAGTTCTGCTGG + Intronic
1174146522 20:48456075-48456097 GAGCCAGCCCAGATCTCAGCAGG + Intergenic
1178263748 21:31123713-31123735 GAGGCAGCCCAGAATTTTGCAGG - Intronic
1180180703 21:46117583-46117605 GCCCCAGCCCAGCATTCTGCCGG + Intronic
1180253160 21:46603304-46603326 TCAGCAGCTCAGCTTTCTGCTGG - Intronic
1181114930 22:20626095-20626117 GCAGCGGCCCAGCTTTCTACTGG - Intergenic
1183952055 22:41357633-41357655 AGGGCAGCCCAGGTTTCAGCGGG - Exonic
1184570136 22:45317799-45317821 GTGGCAGGCCAGAGCTCTGCAGG + Intronic
1184888065 22:47359112-47359134 GCTCCAGCCCAGTATTCTGCAGG + Intergenic
1185323918 22:50216436-50216458 TCTGCTGCCCAGCTTTCTGCTGG - Intronic
950011301 3:9725950-9725972 GCTGCAGCCAAGATCTCTGATGG + Exonic
950261250 3:11544558-11544580 GTGGCAGGCCAGCTTTCTGAGGG - Intronic
953905472 3:46866323-46866345 GCTGCAGCCCAGTGTGCTGCAGG + Intronic
954412093 3:50375202-50375224 GCGCCAGCCCTGCTTTCTGCTGG - Intronic
954673980 3:52305588-52305610 GGGGCAGGCCAGATTTCCGTTGG + Intergenic
962666006 3:137654252-137654274 ACGGCTGCCCAGTTTTATGCTGG - Intergenic
962852790 3:139320157-139320179 GCTGAGGCCCAGATTTCTGAGGG - Intronic
962864395 3:139435240-139435262 GGGGCAGCTCAGCCTTCTGCTGG - Intergenic
963602856 3:147392471-147392493 CCGGAAGCCTAGATTCCTGCCGG + Intronic
964201305 3:154121752-154121774 GCGGCAGCCCAGATTTCTGCCGG + Intronic
965513207 3:169592252-169592274 GCTGATGCCCAGATTTTTGCTGG - Intronic
972640035 4:40916986-40917008 GCTGCACCGCAGACTTCTGCAGG + Intronic
973116223 4:46463669-46463691 GCAGCAGGCCAGATTTCACCAGG + Intronic
973678036 4:53286276-53286298 GCTGAAGCTCAGATTTCTGGGGG - Intronic
974161714 4:58149605-58149627 ACGGCCGCCCAGTTTTGTGCTGG - Intergenic
983602790 4:169549055-169549077 ACGGCAGCCCAGTTTTGTGCTGG + Intronic
984156640 4:176202799-176202821 GCACCAGCCTAGATTCCTGCAGG - Intergenic
988843977 5:35110828-35110850 GAAGCAGCCCAGCTTTCTGTTGG - Intronic
992078770 5:73215470-73215492 TGGACATCCCAGATTTCTGCTGG - Intergenic
993050500 5:82920961-82920983 GCAGCAGCGCAGGTTGCTGCAGG - Intergenic
994982729 5:106897784-106897806 GCTGCAGTCCAGATTCCTTCAGG - Intergenic
995480317 5:112586379-112586401 ACGGCCGCCCAGTTTTGTGCTGG - Intergenic
998217246 5:140246509-140246531 ACAGCAGCCCATATTCCTGCTGG - Intronic
998254786 5:140576430-140576452 ACAGCAGCCCAAATTTCTGGTGG + Intronic
1002059761 5:176619495-176619517 GCGGCATCCCAGACCTCTGCGGG + Intergenic
1002618383 5:180469317-180469339 CCCGCAGCCCAGGTTGCTGCTGG - Intergenic
1004989959 6:21125769-21125791 GCAGCAGCTCTGATTTCTGATGG - Intronic
1010815705 6:80355799-80355821 CCGGCAGCAGATATTTCTGCTGG - Intergenic
1011529287 6:88302465-88302487 GCGGTAGTCCAGATTACTACAGG - Intergenic
1013254266 6:108368891-108368913 GCTCCAGCTCAGATTTCTGCAGG - Intronic
1018533384 6:164792929-164792951 GCTGCAGATCAGATTTCTTCAGG + Intergenic
1019342045 7:512914-512936 GAGGCCGCTGAGATTTCTGCAGG + Intronic
1020092297 7:5348567-5348589 GAGACAGCCCGGATTTCTGCTGG + Intronic
1023167236 7:37354964-37354986 GGCACAGCCCAGAGTTCTGCAGG - Intronic
1023624921 7:42106362-42106384 CTTGCAGCCTAGATTTCTGCAGG - Intronic
1028378069 7:90168190-90168212 ACGGCTGCCCAGTTTTGTGCTGG - Intronic
1041459785 8:58098630-58098652 ACGGCTGCCCAGTTTTGTGCAGG + Intronic
1046306236 8:112371067-112371089 GCAGCTGCCCAGATTTCCCCTGG + Intronic
1047647601 8:126885066-126885088 GCTATAGCCTAGATTTCTGCAGG - Intergenic
1048179570 8:132182583-132182605 GTGGGAGCCCAGATCCCTGCTGG - Intronic
1048538138 8:135316687-135316709 GCAGCAGCCCAGCCATCTGCAGG - Intergenic
1050615424 9:7396817-7396839 AAGGCAGCCCTGAGTTCTGCAGG - Intergenic
1055125755 9:72716850-72716872 ACGGCAGCCCAGTTTTGTGTTGG + Intronic
1057260132 9:93578244-93578266 AAGGCAGCCCAGATTTCCGTGGG - Intronic
1057706029 9:97395831-97395853 GTGGCAGCCCAGATTTCTGCGGG + Intergenic
1059276027 9:113097946-113097968 GAGGTAGCCCTGATTTCTGGTGG - Intergenic
1060816387 9:126637718-126637740 GAGCCAGCCCAGGTTTCGGCGGG + Intronic
1061475556 9:130863514-130863536 GCAGCTGCCCAGACTCCTGCAGG + Intronic
1186380667 X:9055246-9055268 GAGGCAGCGCAGCATTCTGCAGG + Intronic
1189235640 X:39484882-39484904 CCAGCACCCCAGCTTTCTGCGGG - Intergenic
1199954982 X:152735311-152735333 GGGGCAGGGCAGATTTCTGTGGG - Intronic
1200252255 X:154559872-154559894 GCTGCTGCCCAGAGCTCTGCTGG - Intronic
1200265513 X:154644544-154644566 GCTGCTGCCCAGAGCTCTGCTGG + Intergenic
1201798475 Y:17927103-17927125 GCAGCAGTACAGATTTTTGCTGG + Intergenic
1201803078 Y:17978854-17978876 GCAGCAGTACAGATTTTTGCTGG - Intergenic
1202359795 Y:24095793-24095815 GCAGCAGTACAGATTTTTGCTGG + Intergenic
1202510983 Y:25574321-25574343 GCAGCAGTACAGATTTTTGCTGG - Intergenic