ID: 964203495

View in Genome Browser
Species Human (GRCh38)
Location 3:154144744-154144766
Sequence GCAAGTACTCAGCCTCAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 103}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964203495_964203496 8 Left 964203495 3:154144744-154144766 CCTGCTTGAGGCTGAGTACTTGC 0: 1
1: 0
2: 0
3: 9
4: 103
Right 964203496 3:154144775-154144797 GAGATTCAAACACTTTTTTGAGG 0: 1
1: 0
2: 3
3: 28
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964203495 Original CRISPR GCAAGTACTCAGCCTCAAGC AGG (reversed) Intronic
900004699 1:36977-36999 GCAGGTCCTCAGCCGCACGCAGG - Intergenic
901704370 1:11062179-11062201 GAGAGGCCTCAGCCTCAAGCAGG + Intergenic
901943795 1:12684548-12684570 GAAAGTACTGAGCCACATGCTGG + Intergenic
903225159 1:21890467-21890489 TCAAGTACTCCGACTCCAGCTGG + Exonic
903811973 1:26039643-26039665 TCAAGTACTCAGCATGAGGCTGG + Intronic
907687492 1:56626470-56626492 TCAAATATTCAGTCTCAAGCTGG + Intronic
908314358 1:62918221-62918243 GCTGGAACTCAGCCTCAAGTGGG + Intergenic
911119010 1:94276468-94276490 GGAAGTCCTGAGTCTCAAGCTGG + Intergenic
911576649 1:99586199-99586221 GTAAGTACTTAGCCTCAGGAGGG - Intergenic
912392066 1:109310063-109310085 GCATGCCCTCAGCCACAAGCGGG - Exonic
912931183 1:113963674-113963696 GCAAGAACACAGCCACAAGATGG - Intronic
914899002 1:151702115-151702137 GCAAGTCCTCAGCCTTCAGAGGG + Intergenic
918210170 1:182343370-182343392 GCAAGTACTCTGCACCCAGCAGG + Intergenic
920365379 1:205445436-205445458 GCTAGAGCTCAGGCTCAAGCAGG - Intronic
1067941250 10:50659104-50659126 TCCACTGCTCAGCCTCAAGCTGG - Intergenic
1069610267 10:69768143-69768165 TCACGTCCTCAGCCTCCAGCTGG + Intergenic
1070862473 10:79683976-79683998 TCCACTGCTCAGCCTCAAGCTGG - Intergenic
1075422999 10:122317863-122317885 AAAAGTTCACAGCCTCAAGCAGG - Intronic
1076352256 10:129825341-129825363 GCAAGCGCAGAGCCTCAAGCAGG + Intergenic
1078132574 11:8624897-8624919 GCAAGTGATCACCCTCAGGCTGG - Exonic
1079180905 11:18192668-18192690 GCCAGTACTCAGCCTCCAGAAGG - Intronic
1087776495 11:102261384-102261406 GCAACGACAAAGCCTCAAGCAGG - Intergenic
1093418082 12:18943652-18943674 GGAAGAACTCTGCCTCATGCTGG - Intergenic
1105530961 13:21219954-21219976 GCAAGCACTCAGGCTCAAAGTGG + Intergenic
1107370346 13:39738715-39738737 GCAAGCACTAATCCTAAAGCTGG + Intronic
1114850377 14:26376317-26376339 GCAAGGACTCAGACTCAAGTTGG + Intergenic
1117677510 14:58170016-58170038 GCAAATACTCAACCCAAAGCAGG + Intronic
1118997139 14:70846845-70846867 GCAAGTACTCAGCATATAGTGGG + Intergenic
1121079822 14:91098639-91098661 GCAGGTACTCATCCTGAGGCTGG - Intronic
1123401299 15:19989727-19989749 GCAAGTACTCAGGAACCAGCAGG - Intergenic
1123996157 15:25719349-25719371 GCAAGTACTCAGCCTTGTGATGG - Intronic
1125249926 15:37689165-37689187 GCAAGTAGTCATTCTCCAGCTGG - Intergenic
1125928422 15:43582552-43582574 CCAGGTACTCACCCTCAGGCCGG + Exonic
1125935478 15:43631787-43631809 GCAGGGCCTAAGCCTCAAGCTGG - Intronic
1125941588 15:43682387-43682409 CCAGGTACTCACCCTCAGGCCGG + Intergenic
1125948253 15:43728262-43728284 GCAGGGCCTAAGCCTCAAGCTGG - Intergenic
1128682809 15:69663840-69663862 CCAAGTTCTCAGCCTTCAGCAGG - Intergenic
1130066183 15:80606795-80606817 GGAAGAACTCAGCCTCAGGCAGG + Intergenic
1130657013 15:85798824-85798846 GTAAGTACTCAGACTCAACAGGG - Intergenic
1132448810 15:101953967-101953989 GCAGGTCCTCAGCCGCACGCAGG + Intergenic
1133316181 16:4885441-4885463 GCTGGTACTCTGCCTCCAGCTGG + Exonic
1135580528 16:23622284-23622306 GCAAGTAGTCAGCACCAAGATGG + Intronic
1135910435 16:26555742-26555764 GGATGGACTCAGCCTCAAGGTGG - Intergenic
1139531767 16:67545969-67545991 GCACGTCCTCATCCTCCAGCTGG - Exonic
1141494090 16:84394988-84395010 GCATCAACTCAGCCTCAAACAGG - Intronic
1143125720 17:4639988-4640010 GCAGGTCCTCAGCCTCGGGCGGG - Intronic
1143402756 17:6656834-6656856 GCAGGTCCTCAGCCTCGGGCGGG + Intergenic
1143432138 17:6895014-6895036 GCAAGTGCCCAGCCTCTACCTGG - Intronic
1152399777 17:80058914-80058936 CCAAGTACTGAGCCTCAAACAGG - Exonic
1156469596 18:37368988-37369010 GCAAGCACTCAGCCCCCAGGAGG - Intronic
1158850759 18:61493925-61493947 CCAAGTACTCAGCGTCAGGGAGG - Intronic
1160636451 19:78586-78608 GCAGGTCCTCAGCCGCACGCAGG - Intergenic
1166250865 19:41570045-41570067 GCCAGGACTCAGCCTCCAGGCGG + Intronic
925318508 2:2942968-2942990 CCAGATACTCAGCCTCCAGCAGG + Intergenic
926222321 2:10944392-10944414 CCAAGTACTCAGCTCCACGCTGG - Intergenic
927514942 2:23666763-23666785 TCAAGTGCTCAGCCACAGGCTGG + Intronic
928295507 2:30079422-30079444 GCAAGTGCTCTCCCTAAAGCTGG - Intergenic
930088222 2:47513539-47513561 GGAAGTTCTCAGCATCAAGATGG - Intronic
931916178 2:66959527-66959549 GCAGGGTCTCAGCCTTAAGCAGG - Intergenic
935487365 2:103674374-103674396 GAAGGTCCTCTGCCTCAAGCAGG - Intergenic
937515761 2:122653747-122653769 GGAAGAACTCAGCCTGAAGAAGG + Intergenic
937676953 2:124601918-124601940 GCATCTCCTCACCCTCAAGCTGG - Intronic
945549735 2:211206021-211206043 GCAGGTCCTAAGCCTCAGGCAGG + Intergenic
946337906 2:219050579-219050601 GTAAGTACCCTTCCTCAAGCTGG - Intergenic
949003272 2:241629919-241629941 GCAAGTGCCCAGCTTCAGGCGGG + Intronic
1169334409 20:4743706-4743728 GCAGATACTCTGCCTCAAGGGGG + Intergenic
1174482650 20:50842254-50842276 GGCAGGAGTCAGCCTCAAGCTGG + Intronic
1183899723 22:40996042-40996064 GCCAGCACTCAGCCTGGAGCTGG + Intergenic
950440443 3:13007257-13007279 GCAAGGACTCTGTCTCCAGCTGG + Intronic
951683944 3:25324295-25324317 ACAAGAACTCATCCTCAAGGAGG + Intronic
954144203 3:48626319-48626341 AGAAGTGCCCAGCCTCAAGCTGG + Exonic
955954258 3:64272372-64272394 GAAAGAATTCAGCGTCAAGCAGG + Intronic
956174415 3:66459467-66459489 GCAAGTACAGAGCCTCAAGAAGG - Intronic
961778228 3:129305510-129305532 GCAAGCACTCAAACTCAGGCTGG - Exonic
962919166 3:139935549-139935571 GCAAGGACCTAGGCTCAAGCTGG + Intronic
964203495 3:154144744-154144766 GCAAGTACTCAGCCTCAAGCAGG - Intronic
966512605 3:180781151-180781173 GCAGGTACTTAACCTCAAGGAGG - Intronic
969613102 4:8237863-8237885 TCAAGAACTCAGCCTCAGCCAGG + Intronic
973102944 4:46294926-46294948 GCATGTGATCAGGCTCAAGCTGG + Intronic
973132034 4:46659677-46659699 GACAGTTCTCAGCATCAAGCTGG + Intergenic
978191531 4:105918684-105918706 GCAAGTTCTCATCCTCCAGCAGG - Intronic
987428343 5:17799512-17799534 GAAAGGATTTAGCCTCAAGCAGG + Intergenic
997193935 5:131965097-131965119 GGAAGTACACAGGCCCAAGCAGG + Intronic
998603655 5:143611303-143611325 GGAAGAAGTGAGCCTCAAGCAGG + Intergenic
1001555401 5:172633648-172633670 GCAAGTGCTCAGCCTTCAGAAGG + Intergenic
1001951497 5:175819850-175819872 GGATGTTCTCAGCCTGAAGCAGG + Intronic
1002063674 5:176641687-176641709 GCAAATACTCAGCCTCCAGATGG + Intronic
1003391707 6:5718965-5718987 GCAAGCACTCAGGCTCAAAGTGG - Intronic
1003639084 6:7861692-7861714 GCAAGTCCTCAGCTTCAGGATGG + Intronic
1003793609 6:9575105-9575127 GCAAGTATTCAGCTTAAAGTGGG + Intergenic
1004246796 6:13985776-13985798 GCAAGAACTCACCCTCTAGCAGG - Intergenic
1009413291 6:63391323-63391345 GCAACTACTCAGCCAGCAGCTGG + Intergenic
1011132284 6:84064111-84064133 GCAACTACGCAGGCTCATGCAGG + Intronic
1011147661 6:84236342-84236364 TCAAGCACTCAGCCTCTACCAGG - Intergenic
1018281206 6:162187546-162187568 GCAAGTGCCCAGCCTAATGCAGG + Intronic
1018379978 6:163249909-163249931 GCAAATACTTAGCCTCAGACTGG - Intronic
1018689980 6:166337035-166337057 GCAATTACACAGGCTCTAGCAGG + Intronic
1019077764 6:169403642-169403664 GCATGTGCTCACCCTCAAGTGGG - Intergenic
1026284108 7:68948073-68948095 TCAAGGACTCAGCCTGAAGAAGG - Intergenic
1033221902 7:139532490-139532512 GCAACTAGTCAGATTCAAGCAGG + Intronic
1034532514 7:151705412-151705434 GCAAGCACTCGGTCCCAAGCAGG + Intronic
1036158085 8:6361042-6361064 GCAAGGACACAGTCTAAAGCAGG + Intergenic
1044514335 8:93120942-93120964 GCTGGGACTCAGCCTCCAGCTGG - Intergenic
1045930026 8:107611383-107611405 GCAACTGCTCAACCTCCAGCAGG + Intergenic
1048110528 8:131463091-131463113 GGAAGTGCTCATGCTCAAGCAGG + Intergenic
1049887393 9:36759-36781 GCAGGTCCTCAGCCGCACGCAGG - Intergenic
1055007461 9:71525211-71525233 GCGAGTGCACAGCCTCAAGGTGG + Intergenic
1055716149 9:79120510-79120532 GCACCTCCTCAGCCTGAAGCAGG + Intergenic
1060886761 9:127160169-127160191 GCAAGCGCCCAGCTTCAAGCAGG + Intronic
1062057702 9:134477125-134477147 GCTAGCACACAGCCTCCAGCTGG - Intergenic
1186765776 X:12769273-12769295 GCTAGAACTCAGCCACACGCTGG + Intergenic
1189568820 X:42273528-42273550 GCAAGTAGTCAGCCTCAGGGAGG + Intergenic
1197037870 X:121898948-121898970 ACAAGTCCTAAGACTCAAGCAGG + Intergenic