ID: 964203555

View in Genome Browser
Species Human (GRCh38)
Location 3:154145493-154145515
Sequence TGATGGAGACAGAGTGATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 271}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964203551_964203555 22 Left 964203551 3:154145448-154145470 CCATTGAGTTTTAGCTCAGATGG 0: 1
1: 0
2: 1
3: 16
4: 150
Right 964203555 3:154145493-154145515 TGATGGAGACAGAGTGATCTTGG 0: 1
1: 0
2: 2
3: 21
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964203555 Original CRISPR TGATGGAGACAGAGTGATCT TGG Intronic
900931084 1:5738124-5738146 TGATGGAGACAGATGGATAATGG + Intergenic
902170699 1:14608310-14608332 AGATGGGGACTGAGTTATCTTGG + Intronic
902594983 1:17503245-17503267 TGATGGGGACAGGCTGGTCTAGG - Intergenic
903535075 1:24061361-24061383 TGATGGGGACAGGGTGACCCTGG + Intronic
907303825 1:53503125-53503147 TGATGGAGACAGAGAGACCAAGG + Intergenic
908130069 1:61066488-61066510 TAATGGATACAGAGTCAGCTTGG + Intronic
908566861 1:65365815-65365837 TGATTGAGAGAGAGAAATCTTGG + Intronic
909495032 1:76268912-76268934 TGGGGGTGACAGAGTGATCTGGG - Intronic
910425023 1:87113068-87113090 TGTTGGAGCCAGACTGACCTGGG - Intronic
910658006 1:89637969-89637991 TGATGGAGACAAGGTGATACGGG + Intronic
911936927 1:103988483-103988505 TAATCAAGACAGAGTGATATTGG + Intergenic
912461440 1:109834829-109834851 TGATGAAAACAGAGTGTTTTGGG - Intergenic
913182092 1:116332015-116332037 TAAGAGAGACAGAGAGATCTTGG + Intergenic
913349019 1:117837587-117837609 GGAAGGTTACAGAGTGATCTAGG - Intergenic
914096442 1:144547899-144547921 GGGGGGAGACAGAGAGATCTCGG + Intergenic
914302067 1:146386064-146386086 GGGGGGAGACAGAGAGATCTCGG - Intergenic
915359472 1:155277539-155277561 TGATGGCCACAGAGGGCTCTAGG + Intronic
915526914 1:156481454-156481476 AGATGGAGACAGAGAGAGCGGGG + Intronic
915676660 1:157538360-157538382 TGAAGGAGACAGTGTGATTTGGG - Intronic
915677106 1:157542141-157542163 TGAAGGAGACAGTGTGATTTGGG - Intronic
915686416 1:157638999-157639021 TTAAGGAGACAGTGTGATTTGGG - Intergenic
916549258 1:165833652-165833674 TGATGGAGACAGATTGTCTTTGG + Intronic
919523033 1:198612959-198612981 AGATGAAGAAACAGTGATCTCGG + Intergenic
921035520 1:211374691-211374713 TCAGGAAGACAGAGTGAACTTGG - Exonic
921333284 1:214061974-214061996 AGATGGAGTCAGAGAGATCATGG - Intergenic
921767558 1:218990253-218990275 TGGTGGTGACAGAGTGACATGGG + Intergenic
922052783 1:222010065-222010087 AGATGGAGACATAGCGTTCTGGG - Intergenic
922183811 1:223256883-223256905 TGCTGTGGACAGAGTGACCTTGG + Intronic
923565693 1:235074294-235074316 TCTTGGAGACAGAGTGATGGTGG - Intergenic
1063153812 10:3359940-3359962 TGCTGGAGATAGACTGATCAGGG + Intergenic
1063793643 10:9484837-9484859 TGATGGAGGCTGAGTGATCAAGG - Intergenic
1065306849 10:24377265-24377287 TGATGGAAACAGAGGGAGATTGG + Intronic
1066325599 10:34354805-34354827 TGATGGAGACTGGTTGATCCTGG + Intronic
1066361008 10:34730758-34730780 TTTTGGAGACAGAGTCACCTTGG - Intronic
1067832767 10:49619963-49619985 ACCTGGAGACAGAGGGATCTCGG + Intronic
1070628821 10:78069885-78069907 TGAAGAAGACAGAGTGCTGTGGG + Intergenic
1075227402 10:120642082-120642104 TCATGGAGAAGGTGTGATCTGGG + Intergenic
1075811023 10:125224956-125224978 TGATTTAGACAGACTGAGCTGGG + Intergenic
1078723298 11:13903767-13903789 TGATGGAGCAAGAGTGCTATGGG - Intergenic
1078906395 11:15692094-15692116 TGATCTAGACTGAGTGATTTTGG - Intergenic
1080231032 11:30017513-30017535 AGACGGAGACTGAGGGATCTGGG - Intergenic
1080261475 11:30353933-30353955 TGAGGAAGACAGTGTGATCAAGG + Intergenic
1080569934 11:33546527-33546549 TGATGATGACAGTGTGAACTAGG - Intronic
1080616495 11:33949176-33949198 TGCTGGAGCCAGAGTGAACAAGG + Intergenic
1080894845 11:36440546-36440568 TGATGGCAACAGAATAATCTGGG + Intronic
1082792564 11:57356845-57356867 TGATGCAATTAGAGTGATCTTGG + Intronic
1083198744 11:61106560-61106582 TGATGGTGACAGAGTGACCCAGG - Intronic
1086152773 11:83630683-83630705 TTAGGGAGGCAGAGTGATGTGGG + Intronic
1086748948 11:90466103-90466125 TGATGAAGACAGCATGATATTGG + Intergenic
1086852277 11:91823514-91823536 GGAGGGAGAGAGAGAGATCTAGG + Intergenic
1087370216 11:97274244-97274266 TCATACAGACAGAGTGATGTTGG - Intergenic
1088914996 11:114220793-114220815 TCATGAGGACAGAGTGAGCTGGG + Intronic
1089203691 11:116741039-116741061 TGATGGGGACACAGTGACCAGGG + Intergenic
1092296696 12:7205674-7205696 TGATGGAAAAAGAGTACTCTGGG - Intronic
1093137518 12:15470046-15470068 TTTTGGAGACACAGAGATCTGGG - Intronic
1094384361 12:29877950-29877972 TTAGGGAAAGAGAGTGATCTAGG - Intergenic
1095282729 12:40374848-40374870 TGAAGAAGGCAGAGTGAGCTTGG + Intergenic
1095368898 12:41442598-41442620 AGAGGAAGACAGAGTGATATGGG - Intronic
1095819716 12:46464327-46464349 TAATGAAGACAGAATGATCTGGG - Intergenic
1096229609 12:49889697-49889719 GGAGGCAGACAGAGGGATCTGGG - Intronic
1096708879 12:53441151-53441173 TGAAGGAGGCAGAGGGATCACGG + Intergenic
1097131036 12:56810783-56810805 TCATGGAGCCAGCGGGATCTGGG - Intergenic
1097430746 12:59503010-59503032 TGAGGGAGGCAGGGTGATTTAGG - Intergenic
1098505963 12:71251042-71251064 TTGTGGAGAAAGAGTGAGCTAGG - Intronic
1098672929 12:73253343-73253365 TGAAGAAGACAGATGGATCTTGG + Intergenic
1098717256 12:73845959-73845981 TGATGTAAAAAGAGTGATCAAGG + Intergenic
1098733200 12:74064737-74064759 TGAAGAAGACAGATGGATCTTGG + Intergenic
1098749750 12:74278681-74278703 TGCAGAAGACAGAGGGATCTTGG + Intergenic
1099232551 12:80044023-80044045 TGAAGGAGACAGAGTGATGAGGG + Intergenic
1101521588 12:105487166-105487188 TGATGGTGACAGTGTGATGGTGG + Intergenic
1102319843 12:111923183-111923205 TAATTAAGACAGTGTGATCTTGG + Intergenic
1102884755 12:116512982-116513004 TGTTGAAGACAGAGGGATCCAGG + Intergenic
1104951413 12:132442235-132442257 TGAGGAAGACCCAGTGATCTGGG - Intergenic
1106865802 13:33962316-33962338 TGAAGGAGACAGGATGAGCTGGG - Intronic
1107600731 13:42010012-42010034 TGATGGAGGCAGAAGAATCTGGG - Intergenic
1108914404 13:55589787-55589809 TGCTGAAGACAGATGGATCTTGG - Intergenic
1109256820 13:60093266-60093288 TGATGTAGACAGAGTAAAATCGG + Intronic
1110718261 13:78732333-78732355 TAATGTAGACAGAGTGGTCAGGG + Intergenic
1111218983 13:85179973-85179995 TGAAGAAGACAGGGTGATTTGGG + Intergenic
1111482091 13:88843012-88843034 TAATGGGGACAGAGAGAACTGGG - Intergenic
1111483698 13:88866963-88866985 AGATGGAGACAGAGGCATCTTGG + Intergenic
1113114127 13:106856991-106857013 CCATGGAGAAAGAGGGATCTTGG - Intergenic
1113891283 13:113736883-113736905 TGATGGAGACAGGGTGGCTTGGG + Exonic
1114343329 14:21768625-21768647 TGATGGAGACAGAGAGATCCAGG + Intergenic
1114733080 14:25015298-25015320 AGCTGGAGACAGAGATATCTGGG + Intronic
1115070707 14:29318727-29318749 TGCAGAAGACAGATTGATCTTGG + Intergenic
1116960096 14:50960279-50960301 TGATTGAGACTAAGTGATTTGGG - Intergenic
1121334328 14:93068283-93068305 TAATGGACACAGATTGCTCTTGG - Intronic
1121865443 14:97358588-97358610 TGAAGGAGAAAGAGTTACCTAGG - Intergenic
1124033757 15:26034552-26034574 TTTTTGAGACAGAGTCATCTTGG + Intergenic
1124585975 15:31007369-31007391 TAATGAAGACAGTGTGGTCTTGG - Intronic
1128518831 15:68361902-68361924 TAATGGAGAAAAACTGATCTTGG + Intronic
1128808788 15:70555083-70555105 TGATGGGGAGAGACTGATCCAGG + Intergenic
1131077140 15:89502475-89502497 AGCTGGAGACAGAATGTTCTGGG - Intergenic
1133382645 16:5344299-5344321 TGATGTAGAAAGAGGGAGCTGGG - Intergenic
1133838694 16:9389021-9389043 TGAGGGGGACAGAGAGAGCTTGG + Intergenic
1135970010 16:27065519-27065541 TTTTTGAGACAGAGTGATCTCGG - Intergenic
1136033756 16:27522476-27522498 TAATGGAGACAGTGTGATACTGG - Intronic
1137743490 16:50803516-50803538 TGAGGGAGACAGAATCAACTTGG + Intergenic
1139315745 16:66066849-66066871 TGATGGAAAGAGAGTGAAATAGG + Intergenic
1139599260 16:67976758-67976780 TGATGTGGTCAAAGTGATCTAGG + Exonic
1140607745 16:76561969-76561991 TGTTGAAGACAGAATGATGTGGG + Intronic
1141004366 16:80338185-80338207 TGATGGAGACTGAGAGCTGTGGG - Intergenic
1141108538 16:81253260-81253282 TGCAGTAGACAGAGTGATCAAGG - Intronic
1141436108 16:84000828-84000850 TGAGGGAGACAGAGGGAAGTGGG + Intronic
1141760379 16:86025263-86025285 TGAGGGAGAGAGGGTGGTCTGGG - Intergenic
1142787997 17:2240102-2240124 GGATAGGGACAGAGTCATCTCGG - Intronic
1143872655 17:9968427-9968449 TGATGGACTTAGAGTGAGCTGGG - Intronic
1144671811 17:17137073-17137095 AGATGCAGACAGAGCGAGCTGGG - Intronic
1145037982 17:19554551-19554573 TTATGGGGACAGCGTGACCTTGG + Intronic
1147597907 17:41728396-41728418 TGGGGGAGACAGAGGCATCTGGG - Intronic
1149374155 17:56027313-56027335 TGTTGGAGTCACAATGATCTGGG + Intergenic
1149679674 17:58496699-58496721 TGATGGAGGCAGTGGGATATTGG - Intronic
1149980391 17:61306197-61306219 TGTTGGCAACAGTGTGATCTTGG + Intronic
1150050660 17:61958973-61958995 TGATGGAGTCAGAGAGACCTGGG - Intronic
1150788153 17:68179212-68179234 TGCTGCATACAGAGTGACCTGGG + Intergenic
1151169004 17:72230466-72230488 TAATCAAGACAGAGTGATATTGG - Intergenic
1151206093 17:72508227-72508249 TGCTGGAGACAGAGTTCTCCAGG + Intergenic
1151342439 17:73480655-73480677 TCAGAGAGACAGAGAGATCTAGG + Intronic
1152010804 17:77713361-77713383 TAATGAAGACAGTGTGATATTGG - Intergenic
1153019034 18:610374-610396 TGAAGGAGACAGAGAAGTCTGGG + Intronic
1153434240 18:5052012-5052034 TGATGAAGACAGACAGGTCTGGG - Intergenic
1154103516 18:11499506-11499528 GGATGGAGACAGAGAAACCTAGG - Intergenic
1157640475 18:49207796-49207818 AGATGGAGACAGAGCTATTTTGG - Intronic
1161228557 19:3160336-3160358 AGATGGAGACAGAGAGAACAGGG - Intronic
1161601973 19:5189805-5189827 TCAGGGAGACACAGGGATCTGGG - Intronic
1165811360 19:38613961-38613983 AGAGGGAGACATAGTGATCTGGG + Intronic
1167381179 19:49139040-49139062 TGAGGGAGACAAAGAGATATTGG + Intronic
925420328 2:3704801-3704823 TGATGGACACAGAGTGAGAGGGG - Intronic
926444996 2:12930787-12930809 TGTTGGAGATAGAATGCTCTAGG + Intergenic
927877395 2:26667682-26667704 TGATGAATGCAGAGTGATGTTGG - Intergenic
928382000 2:30826037-30826059 TCCTGGAGACAAAGGGATCTGGG - Intergenic
928455972 2:31422402-31422424 TGATGCAGACAGATTGAAGTGGG - Intergenic
929662477 2:43801771-43801793 TGTTGGAGACAAAGTGAACATGG - Intronic
933710594 2:85322896-85322918 TGATGGAGAGAGAGGAATCCTGG + Intronic
934909074 2:98234152-98234174 TGACCTAGACAGAGTTATCTAGG + Intronic
935314477 2:101817869-101817891 TTATTGAGACTGATTGATCTTGG + Intronic
935351042 2:102152019-102152041 GGCTGGAGACAGAGGGGTCTTGG + Intronic
936291758 2:111230700-111230722 TGATCAAGACAGTGTGATATTGG + Intergenic
936691065 2:114889259-114889281 TGCTGGAGACAGTGTGAACACGG - Intronic
937976416 2:127584681-127584703 TCATGGAGGCAAAGAGATCTGGG - Intronic
938109616 2:128555049-128555071 TGATGGGCACTGACTGATCTCGG - Intergenic
938935299 2:136122277-136122299 TGTTGGAGACAGAAGGATTTAGG - Intergenic
940044719 2:149397344-149397366 TGATGGAGACAGAGGCCTCATGG - Intronic
940101753 2:150048179-150048201 ATCTGGAGACAGAGTGATTTGGG - Intergenic
940495324 2:154420343-154420365 TAATGGAGACAAATTCATCTTGG - Intronic
940898203 2:159101780-159101802 TAATGGGCCCAGAGTGATCTGGG - Intronic
941032984 2:160534220-160534242 ACATGAAGACAGATTGATCTTGG + Intergenic
941240584 2:163031666-163031688 TAATGAAGACAGTGTGATATTGG + Intergenic
942689118 2:178566571-178566593 TGATGGCGGCAGTGAGATCTTGG - Exonic
945042064 2:205750769-205750791 TGATGGAGACATAAAGATATAGG + Intronic
945893529 2:215456741-215456763 TGTTGTAGACAGAGTGATCAAGG + Intergenic
945896652 2:215490373-215490395 GGATGTAGACAGAATGATATAGG + Intergenic
946764889 2:223031323-223031345 TGATGGAGACACAGCGTTTTTGG + Intergenic
1168881889 20:1213267-1213289 TGCCGTTGACAGAGTGATCTGGG + Intergenic
1170057391 20:12221582-12221604 TGCTGGAGACTGGCTGATCTGGG + Intergenic
1172204661 20:33154486-33154508 TGATGGAGACAGAGGGAGACAGG - Intergenic
1172281850 20:33713358-33713380 TGAAGGAGACAGAGTTGTCCAGG - Intronic
1172606405 20:36217093-36217115 TGATGTAAACAGAGTGATGGGGG + Intronic
1173264626 20:41468064-41468086 TGATTTAGAAAGAGTGGTCTAGG - Intronic
1173958515 20:47053225-47053247 GGGTGGAGAGAGAGAGATCTGGG - Intronic
1177454312 21:21316479-21316501 TGTTGGAGAAAGGGTCATCTTGG - Intronic
1179229763 21:39491198-39491220 TTTTAGAGACGGAGTGATCTCGG + Intronic
1179646643 21:42779979-42780001 TGCTGGAGACAGCTTGAGCTTGG + Intergenic
1183031487 22:35109835-35109857 TGTTGGAGGCAGAGATATCTGGG - Intergenic
1184253318 22:43273205-43273227 AGATGGAGACAGACAGAGCTGGG + Intronic
1184513440 22:44946129-44946151 TGCTGGAGCCAGAGTGGTCACGG + Intronic
1185072391 22:48663487-48663509 TGATAGAGACAGAGTCAGCTGGG - Intronic
949793033 3:7814412-7814434 GCCTGGAGACAGATTGATCTGGG - Intergenic
950690448 3:14651911-14651933 TGATGGAGACACGGTGAACCCGG - Intronic
951281531 3:20756071-20756093 TGATGGGGACAGAATGAGTTTGG - Intergenic
951384438 3:22026874-22026896 TGCAGAAGACAGAGGGATCTTGG + Intronic
951447503 3:22799594-22799616 TGAAGGAGACACATTTATCTTGG - Intergenic
952953913 3:38544962-38544984 TGTTGGAGACACAGAGAACTGGG + Intergenic
953624023 3:44555766-44555788 AGATTGAGACACAGGGATCTGGG + Intronic
956892076 3:73623252-73623274 TGAGGGAAACTGAGGGATCTGGG + Intronic
956971287 3:74529870-74529892 TCATGGAAGGAGAGTGATCTTGG + Intergenic
956971299 3:74530033-74530055 TCATGGAAGGAGAGTGATCTTGG + Intergenic
959203760 3:103280145-103280167 TGCAGAAGACAGAGAGATCTTGG - Intergenic
960634814 3:119774045-119774067 TGATCAAGACAGTGTGATATTGG + Intergenic
962737484 3:138338844-138338866 TCAAGGACACAGAGTGATCAGGG - Intergenic
963976113 3:151481900-151481922 TGAGGGTGACTCAGTGATCTAGG - Intergenic
964203555 3:154145493-154145515 TGATGGAGACAGAGTGATCTTGG + Intronic
964468305 3:157023135-157023157 TGATGGTGACTGTGTGATTTAGG - Intronic
964507068 3:157411120-157411142 GGGTGGAGACAGTGTCATCTTGG + Intronic
964716215 3:159725163-159725185 AGATGGAAACAGAGGTATCTTGG - Intronic
967652250 3:192000791-192000813 TTTTTGAGACAGAGTGATCTGGG - Intergenic
967967544 3:194973955-194973977 GGATGGAGACAGGGAGAGCTGGG - Intergenic
969267564 4:6074482-6074504 TGATGGACAGAGAGTGATGGGGG + Intronic
969367558 4:6707140-6707162 TGTGGGAGACAGAGTGAAATTGG - Intergenic
969534704 4:7748664-7748686 GGATTGAGACAGAGTCGTCTGGG - Intergenic
969893003 4:10276940-10276962 TGATGGGGACGGAGAGCTCTAGG + Intergenic
971455727 4:26841995-26842017 TGAGAGAGAAAGAGAGATCTTGG + Intergenic
971774921 4:30950806-30950828 TGAGGGAGACAGAGGGGACTAGG + Intronic
977490184 4:97700967-97700989 TGAGGAAGACAGATGGATCTTGG - Intronic
978658391 4:111094506-111094528 TAATGAAGACAGAGTGATATTGG + Intergenic
979285547 4:118920152-118920174 TGAAGGAGAAAGAGGAATCTGGG + Intronic
979556654 4:122055654-122055676 TGATGCTGACAGGGTGAACTCGG - Intergenic
981117478 4:141008772-141008794 TAATGAAGACAGTGTGATATTGG - Intronic
981526974 4:145716289-145716311 AGATGGAGACAAAGGGCTCTAGG - Intronic
982398804 4:154943122-154943144 TGATTGAGCCAAAGAGATCTTGG - Intergenic
982466482 4:155739423-155739445 TGATGGTGACACCTTGATCTTGG + Intergenic
982588830 4:157278240-157278262 TAATCAAGACAGAGTGATATTGG + Intronic
983770547 4:171543832-171543854 TGTTGGAAACAGAGGGATTTGGG - Intergenic
984403113 4:179292420-179292442 TGCTGGTGCCAGAGAGATCTGGG + Intergenic
986613522 5:9593544-9593566 TGATGGAAACAGGGAGACCTGGG - Intergenic
987116898 5:14732873-14732895 GGATGGAGGCAGAGGGATTTAGG - Intronic
987222323 5:15803304-15803326 AGAAGAAGACAGAGTGATGTGGG - Intronic
987787962 5:22526641-22526663 TGCTGAAGACAGATGGATCTTGG - Intronic
990046977 5:51444840-51444862 TGAAGGATACAGAGTGAGCAGGG + Intergenic
994158371 5:96528280-96528302 TGAGGGAGACAGTGTCATCCTGG + Intronic
997078978 5:130715781-130715803 TGAGGCAGACAGAGTCAGCTGGG + Intergenic
997135143 5:131317546-131317568 TGATGTAGTAAGAGGGATCTTGG + Intronic
997996645 5:138591873-138591895 TGGTGGGGAGAAAGTGATCTAGG - Intergenic
998290444 5:140909447-140909469 TGAAGAAGACAGATGGATCTTGG - Intronic
998736593 5:145148848-145148870 TGATGGACACTGAGTGGGCTTGG + Intergenic
998822642 5:146070563-146070585 TCATGAAGAGAGAGTGACCTGGG - Intronic
999856087 5:155595726-155595748 TTCTGGAGACAGAGAGACCTAGG - Intergenic
999885688 5:155920458-155920480 TGATGGAGACACACTGAGCTGGG + Intronic
1000024644 5:157348028-157348050 TGATGGAGAAAGTGTGAGCCTGG - Intronic
1000335557 5:160239007-160239029 TTATGGAGACAAAGTCAGCTGGG + Intergenic
1004592491 6:17067187-17067209 TTATGGAGCCAGAGCGAACTAGG + Intergenic
1004923606 6:20399354-20399376 CTTTGGAGTCAGAGTGATCTGGG - Intergenic
1007234737 6:40382442-40382464 AGATGGAGTAAGAGGGATCTAGG - Intergenic
1007357395 6:41331682-41331704 TGGTGGTGACTGAGTGATTTAGG + Intergenic
1009555478 6:65159337-65159359 TAATGTAGAAAGAGTGCTCTAGG + Intronic
1011881616 6:92034760-92034782 TGATGGACCCAGAGGGATTTGGG - Intergenic
1013348838 6:109288179-109288201 TGAGGGAGACGGAGGAATCTAGG + Intergenic
1014235695 6:118951805-118951827 TCATGGAGATAGAGTTTTCTTGG + Intergenic
1016008733 6:139116177-139116199 AGGTGGGGACAGAGAGATCTGGG - Intergenic
1017299622 6:152841375-152841397 TGATGGCCACCAAGTGATCTTGG + Intergenic
1019134916 6:169902038-169902060 TGATGGGGAGACAGTGATATTGG + Intergenic
1019134954 6:169902219-169902241 TGATGGGGAGACAGTGATGTTGG + Intergenic
1019697105 7:2452052-2452074 TGGTGGAGTCAGTGTGAACTTGG - Intergenic
1020273929 7:6613930-6613952 CTTTGGAGACAGAGTCATCTAGG - Intergenic
1024163089 7:46700159-46700181 TGATCGAGGCAGTGTGATATTGG + Intronic
1024585346 7:50837069-50837091 AGATGGAGTCAGAGAGATCAAGG - Intergenic
1027632250 7:80621079-80621101 TGATGGCTACTGACTGATCTAGG - Intronic
1027692223 7:81362099-81362121 TGATGAATACAGAATGAACTGGG + Intergenic
1028789915 7:94842359-94842381 TCATGGGGACAGTGTGATATTGG - Intergenic
1030797819 7:113810538-113810560 TAATGGAGACAGAATGAGCAGGG + Intergenic
1031061048 7:117051787-117051809 TGAGGGAGACAGAGAAATCAAGG + Intronic
1036184793 8:6613699-6613721 AGATAGAGACAGAGTCATCAGGG + Intronic
1036679631 8:10861746-10861768 TGAAGGACTCAGAGAGATCTTGG - Intergenic
1039726875 8:40227765-40227787 AGAGGAAGACAGAGTGATCCAGG - Intergenic
1039822608 8:41147051-41147073 TAATGGAGACAGTGTGACCATGG + Intergenic
1040013515 8:42681837-42681859 TCATGGTGACAGAGGGAGCTAGG + Intergenic
1040668270 8:49657230-49657252 TCATGGAGACAGAGTTATCAGGG - Intergenic
1041159534 8:55025339-55025361 TAATGGAGACAGATGGATCGAGG + Intergenic
1041360385 8:57046835-57046857 GGATGCAGACACAGTGAACTTGG - Intergenic
1042949286 8:74184521-74184543 TATTGCAGACAGAGTGATTTGGG - Intergenic
1043306614 8:78804225-78804247 TGATGGAGGCAGAATGAAATAGG - Intronic
1044454113 8:92372024-92372046 TTATGGAGACAATGTGATTTGGG + Intergenic
1045801318 8:106104640-106104662 TCAGGGAGACAGAGTAATCTAGG + Intergenic
1045931348 8:107630515-107630537 TGATGATGACAGACTGATATTGG + Intergenic
1046182318 8:110667235-110667257 CAAAGGAAACAGAGTGATCTAGG + Intergenic
1046824980 8:118678762-118678784 TGTTGGAGGCAGATTGCTCTGGG + Intergenic
1046862237 8:119106509-119106531 GGATAGACACAGAGTGCTCTAGG - Exonic
1047049981 8:121100066-121100088 CCCTGGAGTCAGAGTGATCTTGG + Intergenic
1047313370 8:123710905-123710927 TGAAGGAGACAGAGGGGTCAAGG - Intronic
1047758659 8:127938014-127938036 TGAGGGAAAGAGACTGATCTTGG - Intergenic
1047770463 8:128026542-128026564 AGATGGAGACAGAGGGATCTGGG - Intergenic
1048328399 8:133455781-133455803 GGAGGGAGAGAGAGTTATCTTGG + Exonic
1049249626 8:141581231-141581253 TGATAGAGACAGAGAGAGCCTGG + Intergenic
1051497575 9:17741903-17741925 TGATGGAGAAGGTGTCATCTGGG + Intronic
1051740960 9:20251790-20251812 TGTGGGTGACAGAGGGATCTTGG - Intergenic
1052370574 9:27659931-27659953 TGTTGGAGTCAGAGAGATGTGGG + Intergenic
1055350601 9:75382870-75382892 TGGTTGAGACAGAGTGAGCAAGG + Intergenic
1055456347 9:76475651-76475673 TCACGGAGACAGAGTGATGTGGG + Intronic
1055731919 9:79287244-79287266 TGTTGGAGTCAGAGGCATCTGGG + Intergenic
1056467928 9:86877269-86877291 TGTTTGAGCCAGAGGGATCTGGG + Intergenic
1057304879 9:93906282-93906304 TGATGGAGACACAGTTAGGTGGG - Intergenic
1058767645 9:108197646-108197668 GGATGGATACAGAGAGATTTGGG + Intergenic
1058785382 9:108381586-108381608 TGTGGGAGCCAGAGTGATCTAGG + Intergenic
1059014963 9:110505590-110505612 GGAAGGAGAGAGAATGATCTGGG - Intronic
1060750213 9:126163845-126163867 TACTGGAGCCAGACTGATCTTGG - Intergenic
1061599643 9:131659274-131659296 AGATGGAGACAGAGGGCTATGGG + Intronic
1185559243 X:1046230-1046252 TGATGCAGGCAGAGAAATCTAGG - Intergenic
1187369433 X:18692493-18692515 TGAGGGAGACAGAGACATCGAGG - Intronic
1187604744 X:20870955-20870977 TGCAGGAGACAGATGGATCTTGG + Intergenic
1188424234 X:30028065-30028087 CGCTGGACACAGAGTGATCAGGG + Intergenic
1189628306 X:42922200-42922222 TCATGGAGAGAGAGAGATTTGGG + Intergenic
1190060349 X:47206984-47207006 TGATGGAGGGAGAGTGCTATTGG - Intronic
1190996858 X:55618378-55618400 TGCAGAAGACAGATTGATCTTGG - Intergenic
1191859939 X:65657872-65657894 TGATGGTGGCACAGGGATCTGGG - Intronic
1191923564 X:66284099-66284121 TAATCAAGACAGTGTGATCTTGG + Intergenic
1192327495 X:70145338-70145360 TGATGGAGATAGTGGGATGTGGG - Intronic
1192796250 X:74425983-74426005 TGATGGAAACAGAATTTTCTAGG + Intronic
1193293516 X:79806224-79806246 GGATGGAGGAAGAGTGATGTTGG + Intergenic
1193819881 X:86148602-86148624 CGATAGAGACAGAGTGACCATGG + Exonic
1194604501 X:95962884-95962906 TGAAGAAGACAGATAGATCTTGG - Intergenic
1195584273 X:106546139-106546161 TTATGGACACAGAGAGACCTGGG - Intergenic
1198699353 X:139381152-139381174 TGTGCGAAACAGAGTGATCTTGG - Intergenic
1199033589 X:143028089-143028111 TGAGGGAGAGAGAGTAATTTGGG + Intronic
1201296551 Y:12468126-12468148 TAATGGAGAAAGAGTAATCCAGG - Intergenic