ID: 964203585

View in Genome Browser
Species Human (GRCh38)
Location 3:154145804-154145826
Sequence CTGTGTAAATGGCAATTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 223}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964203581_964203585 14 Left 964203581 3:154145767-154145789 CCACAGATGTAGGACTGGCTGTA 0: 1
1: 0
2: 0
3: 8
4: 110
Right 964203585 3:154145804-154145826 CTGTGTAAATGGCAATTTGAGGG 0: 1
1: 0
2: 1
3: 6
4: 223
964203582_964203585 -10 Left 964203582 3:154145791-154145813 CCATAGATAAGTTCTGTGTAAAT 0: 1
1: 0
2: 0
3: 18
4: 224
Right 964203585 3:154145804-154145826 CTGTGTAAATGGCAATTTGAGGG 0: 1
1: 0
2: 1
3: 6
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964203585 Original CRISPR CTGTGTAAATGGCAATTTGA GGG Intronic
903176064 1:21581522-21581544 CTGCTTAAATGTCAATTTAAAGG - Intergenic
905756094 1:40510238-40510260 CTGTGAAATTAGCCATTTGATGG + Intronic
905827460 1:41036843-41036865 CTGTATAAATGGCCATATCAGGG - Intronic
906548804 1:46643638-46643660 CTGTGTAATTGCCACTTTCATGG + Intronic
906843266 1:49162272-49162294 CAGAGTAAATGTCAATTTTAGGG - Intronic
908350669 1:63284234-63284256 ATGGTTAAATGGCAAATTGAAGG + Intergenic
908992767 1:70113193-70113215 TTGTCTGAATGGAAATTTGATGG + Intronic
909362621 1:74781581-74781603 CTGTGTACAATGAAATTTGATGG - Intergenic
911561397 1:99410518-99410540 GTGTGTAAATGACAAGTTAATGG + Intergenic
917033856 1:170724817-170724839 CAATGTGAATGGTAATTTGATGG + Intronic
917960007 1:180134674-180134696 CTGCGTAAATGGCCCTTTCACGG - Intergenic
918091484 1:181298952-181298974 CTCTGTAAACAGCTATTTGAGGG - Intergenic
918890107 1:190256008-190256030 CTGGGTAAATGACAAAATGAAGG - Intronic
919123813 1:193372858-193372880 CTGTGTAAATGGCCTTATGTGGG - Intergenic
919146495 1:193642633-193642655 CTGGGTAAATGGCAAAATTAAGG - Intergenic
921280208 1:213559104-213559126 CTGTGAAGATTTCAATTTGATGG - Intergenic
921497160 1:215855601-215855623 TTGTGTTGATGGTAATTTGATGG - Intronic
922164838 1:223107026-223107048 CTGTGTACATGGCAAAAGGAAGG - Intergenic
922375315 1:224958103-224958125 GTTTGAAAATGGCAAGTTGAAGG + Intronic
924168122 1:241306505-241306527 GTGTGTACATGGCCATGTGAGGG - Intronic
1065766887 10:29038627-29038649 CTATGCAAAAGGAAATTTGAGGG - Intergenic
1067400098 10:45964674-45964696 ATGTGTAAGTGGCAAAATGAAGG - Intergenic
1067868426 10:49933966-49933988 ATGTGTAAGTGGCAAAATGAAGG - Exonic
1068063614 10:52100995-52101017 CTGTGGCCAAGGCAATTTGATGG + Intronic
1070199566 10:74190715-74190737 CTCTGAAAATGGGACTTTGAAGG + Intronic
1072389315 10:94966928-94966950 CTGGGTAAATGACAAAATGAAGG - Intronic
1074277673 10:112019717-112019739 CTGTCTAAATGACTACTTGAAGG + Intergenic
1076151281 10:128163671-128163693 CTTTGTAAATGGCAAATCAAGGG - Intergenic
1076522947 10:131092247-131092269 CTGTGTGAGTGGCATTTTCATGG + Intergenic
1077729215 11:4710640-4710662 CTGTGTAAATGGTAAGTTAGTGG - Intronic
1078176671 11:8977038-8977060 CTGTGTAAATTTTAATTTGTTGG + Intergenic
1078213392 11:9290443-9290465 CAATGTAAATGACAAGTTGATGG + Intronic
1078597621 11:12702056-12702078 CTGTGTAAATGGAGAGCTGAAGG + Intronic
1081303092 11:41477729-41477751 TTGTCTCAATGGCAGTTTGAGGG - Intergenic
1081556337 11:44165487-44165509 CTGAGTGAATTGCAATTTGGTGG + Intronic
1085911113 11:80827892-80827914 ATGTATAAATGCCAATTTGTAGG + Intergenic
1086442325 11:86840861-86840883 CTGGGTAAATAGCAAAATGATGG + Intronic
1086474267 11:87153741-87153763 CACTGTAAAGGGCAAATTGAAGG - Intronic
1089985860 11:122812951-122812973 CTGATTAAATGGCCATCTGATGG + Exonic
1091905955 12:4189296-4189318 CTGTGGAAATGGCAATGGGGTGG + Intergenic
1092498776 12:9025073-9025095 CAATGGAAATGGCAATATGAAGG + Intergenic
1093329225 12:17814638-17814660 TAATGTAAATGGCAAGTTGATGG - Intergenic
1095830563 12:46581959-46581981 TAATGTAAATGGCAAGTTGATGG - Intergenic
1096915786 12:55031343-55031365 ATATGTAAAGGACAATTTGAGGG - Intergenic
1097763083 12:63491392-63491414 CTGGGTAAATGGCAAAATTAAGG - Intergenic
1099170677 12:79360040-79360062 CTGTTTAAAAGGCAATTTCCAGG - Intronic
1099339951 12:81417851-81417873 CTGACTAGATGGCAATTTGTTGG - Intronic
1099620827 12:85000962-85000984 CTGTGAAAATGGCCACTTGCAGG + Intergenic
1099892128 12:88602899-88602921 CAATGTAAATGACAATTTAATGG - Intergenic
1100129303 12:91470836-91470858 CTGCACAAATGGGAATTTGAGGG + Intergenic
1100752456 12:97713966-97713988 GTGTGTAAATCGCAGTTTGGGGG + Intergenic
1101311925 12:103588647-103588669 ATTTGAAAAGGGCAATTTGAAGG + Intronic
1101974412 12:109343313-109343335 CTGTGTAGAATGCAATTTAAGGG + Intergenic
1102193076 12:111003954-111003976 CTCTGTAAATGCCAGTTGGAGGG - Intergenic
1104583186 12:130025982-130026004 GTGTTTTAAGGGCAATTTGAGGG + Intergenic
1106643675 13:31610609-31610631 ATGTATAAATGTAAATTTGAGGG - Intergenic
1107213962 13:37893395-37893417 CAATGTAGATGGCAAGTTGATGG - Intergenic
1107214680 13:37902552-37902574 TAATGTAAATGACAATTTGATGG + Intergenic
1107723000 13:43268758-43268780 ATGTATGAATGGTAATTTGAAGG - Intronic
1107996003 13:45861694-45861716 CTGTGTAAGAGGCCATGTGAAGG + Intergenic
1109332914 13:60952905-60952927 CTTTTTAAAAGGTAATTTGATGG - Intergenic
1110080943 13:71310382-71310404 CTGGAGAAATGGTAATTTGAAGG - Intergenic
1110360592 13:74620612-74620634 CTGGGTACAGGGCAATCTGAGGG + Intergenic
1110826594 13:79978120-79978142 CTGTGTAAATGACAAAATTAAGG + Intergenic
1111791535 13:92862942-92862964 CTGTGTAAATGACAAAAAGAAGG + Intronic
1113009966 13:105752946-105752968 CTGTGTATATGTCAGTTTAAAGG + Intergenic
1113118415 13:106899527-106899549 CTGTGGAAGTGAGAATTTGAAGG - Intergenic
1113302906 13:109042162-109042184 CCTTGTCAAAGGCAATTTGAGGG - Intronic
1116077714 14:40132997-40133019 ATGGGTAAATTGCAAGTTGAAGG + Intergenic
1116793288 14:49362623-49362645 TAATGTAAATGACAATTTGATGG + Intergenic
1118534810 14:66749807-66749829 CTTTGTAAAAGGCACTGTGAAGG - Intronic
1119838288 14:77770794-77770816 CTGTGTTGATGGCATTTTGAAGG - Intergenic
1126278993 15:46920190-46920212 TTGTGTAAATGACATTTTTATGG + Intergenic
1127247574 15:57194431-57194453 CTGTGTAAATGTCATTTAGTGGG + Intronic
1130078493 15:80710450-80710472 CTGTGTTAATGACAAATTGGAGG + Intronic
1130129998 15:81133107-81133129 CTGTGAGAATGGGAATTGGATGG - Intronic
1133094572 16:3433593-3433615 CTGAGTTAATGACAATTTTATGG + Exonic
1133531266 16:6657240-6657262 CTGTATTACTGGGAATTTGAAGG - Intronic
1137661610 16:50211962-50211984 CTGTCTAAAAGGCAATTAGCTGG - Intronic
1138760864 16:59542622-59542644 CTGTCTAAATGGAATTTTTAGGG + Intergenic
1139010103 16:62621577-62621599 CTATGTAAATTCCATTTTGAAGG - Intergenic
1142968236 17:3594213-3594235 CTATGGAAATGGCAATTAGAAGG - Intronic
1148742218 17:49899240-49899262 CTGTGTCAAAGACAATTTAAGGG + Intergenic
1149531907 17:57402298-57402320 CTGTGGAAATGGCAGGTTCAAGG + Intronic
1152343965 17:79740410-79740432 GTGTGTAAATGCCAGTTTTAAGG + Intronic
1155382559 18:25240179-25240201 CTGTATGCATGGAAATTTGAGGG - Intronic
1156080122 18:33323558-33323580 CTGTGAAAATGCCAGATTGAAGG - Exonic
1157731750 18:50010086-50010108 CTGTGTAATTGGCATTTGGCAGG + Intronic
1159467016 18:68796769-68796791 CTGTGTAGATGTCAACTAGAAGG + Intronic
1160101954 18:75929557-75929579 CTGTTCAAATGACTATTTGACGG + Intergenic
1160332310 18:78005649-78005671 CAATGTAAATGGCAATTAAAGGG - Intergenic
1166297369 19:41895660-41895682 CTGTGGAAAGGGCAAACTGAGGG - Intronic
926808740 2:16737749-16737771 CTTTGAACATGGCAATGTGAAGG - Intergenic
927869000 2:26611794-26611816 CTGTGTAATTATCATTTTGATGG - Intronic
930258430 2:49118085-49118107 CTTTGAAAATGTTAATTTGATGG + Intronic
930389427 2:50742295-50742317 ATGTATAAGTGGCAATTTAAGGG - Intronic
930804562 2:55477479-55477501 CTGTTAAAATGGCAATTTTTTGG + Intergenic
933042785 2:77489286-77489308 CTGTGTAAATGAAAACTTGAAGG - Intronic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935002055 2:99028049-99028071 CTGTGTAAATGCCCATGGGAAGG - Intronic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935945384 2:108281505-108281527 AAGTGTAAAGGGTAATTTGATGG - Intergenic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936739981 2:115493308-115493330 GTATGTAAATGGAATTTTGAGGG + Intronic
937875420 2:126821764-126821786 CTGTCTGAATGGAAGTTTGAGGG + Intergenic
939218612 2:139273249-139273271 CTATGTAAAAGGCATTTAGATGG - Intergenic
940836715 2:158530053-158530075 CTATGTTAATGACAATGTGATGG + Intronic
941829606 2:169940026-169940048 CTGTGTAAAAGGTAATGTTAAGG - Intronic
942924491 2:181415735-181415757 GAGTGTCAATGGTAATTTGATGG - Intergenic
943894259 2:193333207-193333229 CTGTGTAGATAGGAATTTGGGGG - Intergenic
944150228 2:196549906-196549928 GTGTGTAAATGGCAAGGTAAAGG + Intronic
944549229 2:200830211-200830233 CAATGTAAATGGCAAGTTAATGG + Intergenic
945910664 2:215645380-215645402 GTGTGCAAAAGGGAATTTGAAGG - Intergenic
947847193 2:233254150-233254172 CTTTGAAAATGGCATCTTGATGG + Intronic
948027960 2:234792847-234792869 CTGTGTAAAAGGAAAATTGATGG - Intergenic
1169685834 20:8270288-8270310 CTGTGTACTTAGCAAGTTGAAGG - Intronic
1169797744 20:9482855-9482877 CTGTGTAAAAGGGATTTGGAGGG - Intergenic
1171039654 20:21748912-21748934 CTGGGTAAATAGCAAAATGAAGG - Intergenic
1171513869 20:25711744-25711766 CTGGGTAAATAGCAAAATGAAGG - Intergenic
1171765250 20:29262273-29262295 ATCTGTAAATGGATATTTGAAGG + Intergenic
1171824771 20:29885094-29885116 ATCTGTAAATGGATATTTGAAGG - Intergenic
1173638355 20:44580885-44580907 CTGTTTCAATGCCACTTTGATGG - Intronic
1174748547 20:53088627-53088649 CTATCTAAATGGAGATTTGATGG + Intronic
1175185992 20:57179903-57179925 CTGTGTAAATGGAGACTTGGTGG + Intronic
1177520717 21:22219919-22219941 CTCTTTAAATGGAAATTTAATGG + Intergenic
1177863866 21:26489043-26489065 ATGTGGAAATGGCAGTTTTAAGG + Intronic
1178266492 21:31147152-31147174 CTTTGTAATGGGCAATTTTAGGG - Intronic
1178393229 21:32216341-32216363 CTCTGGAAATGGAACTTTGAGGG - Intergenic
1179311535 21:40200178-40200200 CTGAGAAAATGGAAATTTCAAGG - Intronic
1179408257 21:41142805-41142827 CAGTTTAAATGGCAAATGGAAGG - Intergenic
1183762608 22:39837209-39837231 GTGTGTATATACCAATTTGAAGG - Intronic
1184076868 22:42185823-42185845 TTGTGTTAATGGCAAGTTAAAGG - Intronic
951276961 3:20699381-20699403 CTAGGTAAAAAGCAATTTGAAGG + Intergenic
955954255 3:64272343-64272365 ATGTGTAATTGGGAATCTGAAGG - Intronic
956399657 3:68863393-68863415 ATGTGTTGATGGCATTTTGATGG - Intronic
956963877 3:74435599-74435621 CTGAGTAAATGGGGATATGAAGG + Intronic
959575189 3:107926167-107926189 CTGTGTAAATGGCATTTCCTCGG + Intergenic
960443335 3:117716590-117716612 CTGCCTAAATGGAAATTTGCAGG - Intergenic
961748520 3:129081570-129081592 CCGTCCAAATGGAAATTTGAGGG + Intergenic
962675767 3:137756964-137756986 TAATGTAAATGACAATTTGATGG + Intergenic
962767237 3:138576853-138576875 CTGTGTAAATAACAAAATGAAGG + Intronic
964136116 3:153346614-153346636 CAATGTAAATGACGATTTGATGG - Intergenic
964203585 3:154145804-154145826 CTGTGTAAATGGCAATTTGAGGG + Intronic
964914327 3:161821269-161821291 CTGGGCCAATGGCAATTTCAAGG - Intergenic
965120831 3:164554016-164554038 ATGTGTAAATGGGAAGTTCAAGG - Intergenic
965851688 3:173034246-173034268 TTGTGTAATTTGCTATTTGAAGG - Intronic
967713282 3:192734117-192734139 CTGTGTATTTGGAATTTTGAGGG - Intronic
971005114 4:22364702-22364724 CTGTGGATGTGGCTATTTGAGGG + Intronic
975129648 4:70820279-70820301 TAGTGTAAATGACAATTTGGCGG - Exonic
975468429 4:74735851-74735873 TTGAGTAAATGGTATTTTGAAGG - Intergenic
977217999 4:94306109-94306131 CTATGTAAAAGGCACTGTGATGG + Intronic
977660497 4:99579678-99579700 CTTTGTAAATGTAAATTGGAAGG - Intronic
979919890 4:126482942-126482964 CTGAGTAAATGTAAATTAGATGG + Intergenic
981017434 4:139988568-139988590 ATCTGTAAATGGCAGTTGGATGG - Intronic
982134712 4:152263767-152263789 CTGTGTAATTGGAAAAATGAAGG - Intergenic
982905341 4:161061604-161061626 CTGAGTACATGGCTATTTCAAGG + Intergenic
987609345 5:20181637-20181659 CTGTGGAAATGGCAGCTTCATGG + Intronic
988818333 5:34856096-34856118 CTCTGAAAATGGCAATTTCAGGG - Intronic
989334510 5:40299983-40300005 CTGGGTAAATGACAAAATGAAGG - Intergenic
995945522 5:117640413-117640435 ATGTGTAAATGGAAAATTGGTGG + Intergenic
996285941 5:121792502-121792524 CTGTTTACATTGCAATGTGATGG - Intergenic
996397791 5:123031202-123031224 TTATGTAAAAGGCAATGTGAGGG + Intronic
996905084 5:128590056-128590078 CTGTGAAAATAACAATTGGATGG + Intronic
997548508 5:134731910-134731932 CTTTATGAATGCCAATTTGAGGG + Intergenic
997868381 5:137484854-137484876 CTTTGTAAATGACATTTTAATGG - Intronic
998580790 5:143373505-143373527 CAGTGTAAATGACGAGTTGATGG + Intronic
998990817 5:147813983-147814005 CTGATTTAATGGCAATATGATGG - Intergenic
1001074975 5:168619545-168619567 CAGTCTAAATGCCACTTTGAAGG + Intergenic
1001106431 5:168858528-168858550 CTATGTAAGTGGCATTTGGATGG - Intronic
1001929031 5:175659548-175659570 ATCTGTAAATTGGAATTTGATGG - Intronic
1004034829 6:11913844-11913866 CTGTTTAAATGTTATTTTGAAGG + Intergenic
1004303332 6:14477929-14477951 ATGTTTAAGTGGCAATTAGAAGG + Intergenic
1004601221 6:17151761-17151783 CTGTGGAAATGGCAATTCCCTGG - Intergenic
1007958065 6:45935114-45935136 CTGTTCAAATGGCAGATTGAGGG + Intronic
1009347148 6:62627679-62627701 GTGTTTAAATGGCAATCTCAGGG + Intergenic
1010329223 6:74602654-74602676 CTGTTTCAATGTCAAGTTGAAGG - Intergenic
1010745934 6:79561693-79561715 GTGTGCAAAGGGCAATTTCATGG - Intergenic
1012015585 6:93845715-93845737 CTGTATAAATGTCAATCAGATGG - Intergenic
1012036586 6:94148993-94149015 CTATATAATTGGCAATATGAAGG + Intergenic
1013771811 6:113636260-113636282 CTATGTAAATGGCCAGTTGTAGG - Intergenic
1014613522 6:123573822-123573844 CTGTGTACATAGCTGTTTGAAGG - Intronic
1015418953 6:132984322-132984344 CTGTGTAAATAACAAAATGAAGG - Intergenic
1016782579 6:147976114-147976136 CAGTGTAAATGGGAAGGTGATGG + Intergenic
1018275486 6:162125810-162125832 AGGTGTAAATGGCTGTTTGATGG + Intronic
1018684271 6:166291173-166291195 TTGTGAAAATGACAATTTGGGGG - Intergenic
1020810252 7:12842435-12842457 CTGGGTAAATAGCAAAATGAAGG + Intergenic
1021813970 7:24429854-24429876 CTGTGCAAATAGCTATGTGAAGG - Intergenic
1023179144 7:37463757-37463779 CTGTGTCAATGTCAATATCATGG + Intergenic
1023477994 7:40601881-40601903 CTTTGAATTTGGCAATTTGAAGG - Intronic
1024010848 7:45265544-45265566 CTGTGCAAATGGCATTTTGAAGG + Intergenic
1028080844 7:86573214-86573236 TAGTGTAAATGACAAGTTGATGG + Intergenic
1030146456 7:106361433-106361455 CTGGGTAAATGACAAAATGAAGG + Intergenic
1034635435 7:152563696-152563718 CTGTGAAAATGGCAATATTCTGG - Intergenic
1035909207 8:3547113-3547135 CTGTGTGAATGGCAGCATGAGGG - Intronic
1040451825 8:47555597-47555619 CTGTGTATATTCCATTTTGATGG + Intronic
1040669518 8:49672571-49672593 AAGTGTCAATGGCAATTTAATGG - Intergenic
1042479093 8:69283077-69283099 CTGGGTAAATGACAAAATGAAGG + Intergenic
1043330686 8:79114829-79114851 CTGTGTAAATAACGATATGAAGG + Intergenic
1043468410 8:80537257-80537279 CCATATAAATGGCATTTTGATGG - Intergenic
1045728906 8:105210835-105210857 CTTTGTAAATGGCATATAGATGG + Intronic
1046285199 8:112084717-112084739 CTGGGTAAATGACAAAATGAAGG + Intergenic
1046413506 8:113879712-113879734 CTATTTAAATGGAAATTTAAGGG - Intergenic
1048149540 8:131880941-131880963 CTGGGTAAATAGCAAAATGAAGG - Intergenic
1051497604 9:17742166-17742188 CTTTTTAAATGGCAGTTTGGAGG + Intronic
1051566129 9:18500381-18500403 CTCAGTAAATGCCAATTTTATGG - Intronic
1052105759 9:24512634-24512656 TGGTTTAAATGGCAATCTGAAGG - Intergenic
1054974678 9:71128395-71128417 CTTTGTGAATGGAAATTTTAGGG - Intronic
1056287188 9:85101371-85101393 CTGTGTAAATGTCAATATCCAGG - Intergenic
1057006450 9:91564982-91565004 CTGTGTCAATGGCTCATTGATGG - Intronic
1191065936 X:56347974-56347996 TAATGTAAATGTCAATTTGATGG - Intergenic
1191068559 X:56376781-56376803 GCATGTAAATGGCAATTTCAAGG - Intergenic
1191963820 X:66734071-66734093 ATATGCAAATGGCAATTTGGAGG + Intergenic
1192144231 X:68670380-68670402 CAGTGGAAAGGGCAATTTCAAGG + Intronic
1192678076 X:73221321-73221343 TAATGTAAATGGCAAGTTGATGG - Intergenic
1192964462 X:76162223-76162245 CTGGGTAAATAGCAAAATGAAGG + Intergenic
1193107119 X:77688594-77688616 CTGTGTAAATAGGATTTGGATGG - Intronic
1193879086 X:86899690-86899712 CTGGGTAAATAGCAAAATGAAGG - Intergenic
1194899237 X:99487471-99487493 CTGTCAAAATGGAAATTTCAAGG + Intergenic
1194974751 X:100382629-100382651 CTCTGGAGATGGCAATTTCATGG - Intronic
1195997703 X:110747492-110747514 ATGTGCATATGGCAATTTGGGGG - Intronic
1198335548 X:135662755-135662777 CTGGGTAAATAGCAAAATGAAGG - Intergenic
1198654491 X:138898805-138898827 CTGTGCAATTGGCAGTTTGAGGG + Intronic
1200895435 Y:8370971-8370993 TTGTGTGAATGGCCATATGAGGG + Intergenic
1200939309 Y:8765669-8765691 CTGGCTAAATCCCAATTTGAGGG - Intergenic
1201566872 Y:15374445-15374467 TAGTGTAAATGACAAGTTGATGG + Intergenic
1201865797 Y:18652811-18652833 CTGTGTGACTGGTACTTTGAAGG - Intergenic