ID: 964203898

View in Genome Browser
Species Human (GRCh38)
Location 3:154148940-154148962
Sequence CTAGCCCAACCCTTAGAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 118}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964203898 Original CRISPR CTAGCCCAACCCTTAGAAAT GGG Intronic
905326097 1:37152999-37153021 GTACCACAACCCTTTGAAATGGG + Intergenic
905484649 1:38286815-38286837 CTGGCCCATCCCTTAGACAAGGG + Intergenic
906651747 1:47517652-47517674 CTACCCCACCCCCAAGAAATAGG - Intergenic
913248302 1:116889830-116889852 CTAACCCAAGGCTTTGAAATCGG + Intergenic
913382998 1:118230709-118230731 CTTACCCAAGCCTTAGAACTGGG + Intergenic
914324277 1:146596112-146596134 GAAGCCAAACCCTTTGAAATTGG + Intergenic
914754221 1:150553841-150553863 CTGGCCCAACCCTGGGAACTTGG - Exonic
916939935 1:169667188-169667210 CTTACCCAAGCCTTAGAACTGGG + Intronic
917086506 1:171310002-171310024 CTTACCCAAGCCTTAGAACTGGG + Intergenic
919257177 1:195139945-195139967 CTTACCCAAGCCTTAGAACTGGG + Intergenic
920531145 1:206703531-206703553 CTAGTCCAATCTATAGAAATTGG - Intronic
923081594 1:230661965-230661987 CTACCCCCACCCTTGGAGATAGG + Intronic
923743705 1:236681336-236681358 CAAACACAACCCTGAGAAATGGG + Intergenic
1063648983 10:7914691-7914713 CTACCCCATCCCTCAGAAAAAGG - Intronic
1063707856 10:8448499-8448521 TTAACCCAACCCTTAAATATTGG + Intergenic
1064246823 10:13674877-13674899 CTAGCTCATCCCGTTGAAATTGG - Intronic
1067060607 10:43076361-43076383 CTGGTCCAACCCTTGGAAACCGG - Intergenic
1068461923 10:57340565-57340587 AAAGCCCAACCCCAAGAAATAGG - Intergenic
1069364820 10:67686203-67686225 CTTACCCAAGCCTTAGAACTGGG - Intronic
1072474473 10:95746507-95746529 CCATCCCAACCCTCAGAGATTGG - Intronic
1072526513 10:96276521-96276543 CTGTCCCAACCCTGAGAAAGGGG - Intergenic
1077696766 11:4400459-4400481 CTATCCCAAACATTAGAAAAAGG + Intergenic
1078376643 11:10800206-10800228 CTAGCTCAACCACTAGAAAGTGG - Exonic
1081146269 11:39564873-39564895 CTTACCCAAGCCTTAGAACTGGG + Intergenic
1084435155 11:69135157-69135179 CTCCCCCCACCCTGAGAAATGGG - Intergenic
1087682942 11:101235494-101235516 CTTACCCAAGCCTTAGAACTGGG - Intergenic
1091573504 12:1711983-1712005 CTTACCCAAGCCTTAGAACTGGG - Intronic
1111012509 13:82329944-82329966 TAAGCCCAACCCCAAGAAATAGG + Intergenic
1111845675 13:93505957-93505979 ATAGCCCAAATCTTAGGAATGGG - Intronic
1114033119 14:18593748-18593770 CCAACCCAACCCTCAGGAATGGG + Intergenic
1114077912 14:19172945-19172967 CCAACCCAACCCTCAGGAATGGG + Intergenic
1114125824 14:19724017-19724039 CCAACCCAACCCTCAGGAATGGG - Intronic
1118518298 14:66551489-66551511 CTAGCTCAAGACTTAGATATAGG - Intronic
1123569056 15:21583316-21583338 CCAACCCAACCCTCAGGAATGGG - Intergenic
1123605166 15:22018637-22018659 CCAACCCAACCCTCAGGAATGGG - Intergenic
1126195671 15:45927718-45927740 CTAGCCCAACCCAAAGGGATTGG - Intergenic
1202977411 15_KI270727v1_random:310406-310428 CCAACCCAACCCTCAGGAATGGG - Intergenic
1136712886 16:32254161-32254183 TTAGCCCCACCCCTAGGAATGGG - Intronic
1136755030 16:32675268-32675290 TTAGCCCCACCCCTAGGAATGGG + Intronic
1136813083 16:33195101-33195123 TTAGCCCCACCCCTAGGAATGGG - Intronic
1136819559 16:33305181-33305203 TTAGCCCCACCCCTAGGAATGGG - Intronic
1136826122 16:33361716-33361738 TTAGCCCCACCCCTAGGAATGGG - Intronic
1136831188 16:33460487-33460509 TTAGCCCCACCCCTAGGAATGGG - Intronic
1138494250 16:57397769-57397791 CTTACCCAAGCCTTAGAACTGGG - Intergenic
1138643255 16:58403252-58403274 GGAGCCAAACCCGTAGAAATGGG - Exonic
1140009283 16:71114732-71114754 GAAGCCAAACCCTTTGAAATTGG - Intronic
1202991659 16_KI270728v1_random:18071-18093 TTAGCCCCACCCCTAGGAATGGG - Intergenic
1203057172 16_KI270728v1_random:935607-935629 TTAGCCCCACCCCTAGGAATGGG + Intergenic
1143220499 17:5257429-5257451 CTAACCCAACCCTCAAAAACTGG - Intergenic
1150990942 17:70258477-70258499 CCTTCCCAACCCTAAGAAATAGG + Intergenic
1153144699 18:2017663-2017685 CTGCCCCAACTCTTAGAAAATGG - Intergenic
1156984205 18:43329741-43329763 CTAGCCCCACCATATGAAATGGG + Intergenic
1159962924 18:74569342-74569364 AAAGCCCAACCTGTAGAAATTGG + Intronic
1160293364 18:77616118-77616140 CTAGCCTAACACTTTGTAATAGG - Intergenic
1162243404 19:9377827-9377849 TCAGCCCAACCCTATGAAATTGG + Intronic
1166205857 19:41268513-41268535 CTCTCCCAACACTTGGAAATAGG - Intronic
925633014 2:5914750-5914772 TTAGCCGCACTCTTAGAAATAGG + Intergenic
925949483 2:8897546-8897568 CTTACCCAAGCCTTAGAACTGGG - Intronic
929330640 2:40676379-40676401 CTTACCCAAGCCTTAGAACTGGG + Intergenic
932508224 2:72257765-72257787 CTAGCCCAGCCCTGGGAAATTGG - Intronic
935718980 2:105962819-105962841 CTGGACCAAGCCTTAGAAAGAGG + Intergenic
942440383 2:176029075-176029097 CTTGCCCAAACCGTAGAAATGGG - Intergenic
942617219 2:177805412-177805434 CCAACCCAATGCTTAGAAATAGG + Intronic
942932363 2:181510833-181510855 CAAGCCAAAACCTTAGCAATTGG + Intronic
946649232 2:221872968-221872990 CTACCCCAACCCTTAGAAAAAGG + Intergenic
946911650 2:224467634-224467656 CTATCTAAACTCTTAGAAATGGG + Intergenic
1180457231 22:15520803-15520825 CCAACCCAACCCTCAGGAATGGG + Intergenic
1183339047 22:37268157-37268179 CTAGCCCTACCCGGAGCAATTGG + Intergenic
1185317082 22:50183899-50183921 CCAGCCCAGCACTGAGAAATGGG + Intergenic
950404899 3:12798091-12798113 TTACCCCAACCCTCAGAGATGGG - Intronic
951312736 3:21149000-21149022 CTATCCCAGCACTTAGGAATAGG - Intergenic
952883329 3:37998626-37998648 CCAGCCCCACCCTCAGAAAGCGG - Intronic
954658641 3:52214137-52214159 CTTGCTCAAGCCTGAGAAATAGG - Exonic
962158211 3:132971584-132971606 ATAGCCAAACTCATAGAAATGGG + Intergenic
964203898 3:154148940-154148962 CTAGCCCAACCCTTAGAAATGGG + Intronic
964558977 3:157972853-157972875 GTAGCACACCCCTTAGATATTGG - Intergenic
966997714 3:185300043-185300065 ATAGTCAAACTCTTAGAAATGGG - Intronic
971578842 4:28308188-28308210 CTTACCCAAGCCTTAGAACTGGG + Intergenic
974187719 4:58463256-58463278 CTTACCCAAGCCTTAGAACTGGG + Intergenic
974526932 4:63058006-63058028 CTTACCCAAGCCTTAGAACTGGG + Intergenic
977229948 4:94440140-94440162 GGAAGCCAACCCTTAGAAATTGG + Intergenic
984939552 4:184919163-184919185 CTAACCCAAGCCTTAGAACTGGG - Intergenic
985014096 4:185614892-185614914 CCAGCCCAGCCCGGAGAAATCGG - Exonic
985028127 4:185759447-185759469 CCAGCTCAATCCTTAGAAAAAGG - Intronic
986485502 5:8232149-8232171 CTTGCCCAAGCCTCAGAACTAGG + Intergenic
988358160 5:30202779-30202801 CTTACCCAAGCCTTAGAACTAGG + Intergenic
992548946 5:77843759-77843781 CTAGCCCTACCCCTACAAAGTGG - Intronic
994231355 5:97313114-97313136 CTTACCCAAGCCTTAGAACTGGG - Intergenic
995583040 5:113620637-113620659 CTTACCCAAGCCTTAGAACTGGG - Intergenic
996098981 5:119428643-119428665 CTTACCCAAGCCTTAGAACTGGG - Intergenic
1002655567 5:180744080-180744102 CTAGCACTAACCTTAGGAATTGG - Intergenic
1006628183 6:35412434-35412456 CAAGCCCACCCCGCAGAAATGGG + Intronic
1007252938 6:40508656-40508678 CTATGCCAACCCTTAAAAATAGG - Intronic
1009385593 6:63081630-63081652 CTTACCCAAACCTTAGAACTGGG - Intergenic
1010075192 6:71789791-71789813 CTTACCCAAGCCTTAGAACTGGG + Intergenic
1013286428 6:108686135-108686157 CAACCCCAACCCTGAGACATGGG + Intergenic
1016022633 6:139252225-139252247 GTTGCCCAGACCTTAGAAATGGG + Intronic
1016184385 6:141181295-141181317 CTTACCCAAGCCTTAGAACTGGG + Intergenic
1020839480 7:13197545-13197567 CTAGCCCAACATGTTGAAATAGG + Intergenic
1040095404 8:43437701-43437723 AAAGCCCAACCCCAAGAAATAGG + Intergenic
1040667499 8:49651844-49651866 CTTACCCGAGCCTTAGAAATGGG - Intergenic
1041344758 8:56885486-56885508 CTATCTCAAGCCTAAGAAATAGG - Intergenic
1042760436 8:72266554-72266576 GAAGCCCAACCCCAAGAAATAGG - Intergenic
1044456267 8:92395718-92395740 CTTACCCAAGCCTTAGAACTGGG - Intergenic
1047072199 8:121357686-121357708 CTTGCACATCGCTTAGAAATGGG - Intergenic
1050803571 9:9645297-9645319 CTAGAGCAACTCTGAGAAATAGG - Intronic
1052057418 9:23920702-23920724 CTTACCCAAGCCTTAGAACTGGG - Intergenic
1054358631 9:64090168-64090190 CTAGCCAAACCCTATGAGATTGG - Intergenic
1056392409 9:86152113-86152135 CTTACCCAAGCCTTAGAACTAGG - Intergenic
1056729576 9:89154069-89154091 CTAGTCCAACCCTTGGCCATGGG + Intronic
1057962558 9:99470658-99470680 CTGCCCCAACCCATGGAAATCGG - Intergenic
1193386304 X:80875683-80875705 CTATAACAACCCTTAGAAGTTGG + Intergenic
1193489188 X:82127065-82127087 CATGCCCTACCCTTAGTAATGGG - Intergenic
1196127001 X:112111628-112111650 CTTACCCAAGCCTTAGAACTGGG - Intergenic
1196794673 X:119492567-119492589 CTAGCACAATCCTGAGAAAAAGG - Intergenic
1198904347 X:141544278-141544300 CTTCTCCTACCCTTAGAAATTGG - Intergenic
1200690034 Y:6297986-6298008 CTGTCCCATCTCTTAGAAATGGG + Intergenic
1201045239 Y:9876734-9876756 CTGTCCCATCTCTTAGAAATGGG - Intergenic
1201404117 Y:13633056-13633078 CTTGCCAAAGCCTTAGAACTGGG + Intergenic
1201515647 Y:14816575-14816597 CTTACCCGAGCCTTAGAAATGGG - Intronic
1202074498 Y:21024877-21024899 CTTACCCAAGCCTTAGAAGTGGG - Intergenic
1202258235 Y:22942476-22942498 CTTACCCAAGCCTTAGAACTGGG + Intergenic
1202411225 Y:24576234-24576256 CTTACCCAAGCCTTAGAACTGGG + Intergenic
1202459556 Y:25093838-25093860 CTTACCCAAGCCTTAGAACTGGG - Intergenic