ID: 964205441

View in Genome Browser
Species Human (GRCh38)
Location 3:154169838-154169860
Sequence TATTGTGACCAGAGGCTTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 494
Summary {0: 1, 1: 13, 2: 43, 3: 132, 4: 305}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964205441 Original CRISPR TATTGTGACCAGAGGCTTGT AGG Intronic
900560330 1:3302127-3302149 AAATGTGACCAGAAGCTTGCAGG - Intronic
901177253 1:7313368-7313390 TTTTCTGAACAGAAGCTTGTTGG + Intronic
902068884 1:13714672-13714694 CAATGTAAGCAGAGGCTTGTGGG + Intronic
902182753 1:14701917-14701939 TACTGAGACCAGAGGCTAGGTGG - Intronic
902305710 1:15537263-15537285 TATTGTGAGCTGAGCCTTGAAGG + Intronic
906428948 1:45738916-45738938 TGTTGTGACTATAGGCTTGCAGG + Intronic
906477157 1:46176960-46176982 TATTGTGACCAGAGGGTTTCAGG - Intronic
907090323 1:51718187-51718209 TATGGTTACCAGAGGCTGGAAGG + Intronic
907260611 1:53215626-53215648 AAATGTGACCAGAGGCTCATAGG - Intronic
907574886 1:55517488-55517510 TCTTTTGACCAGAGGCTTGAAGG + Intergenic
907827054 1:58028237-58028259 TGTTTTGACCAGAGCCTTGCAGG - Intronic
908187170 1:61663631-61663653 TCTTGTGAGCAAAGGCTTGCAGG - Intergenic
909999842 1:82329246-82329268 TACTGGGAAAAGAGGCTTGTTGG + Intergenic
911278330 1:95892267-95892289 TTTTGTGACTAGAGGCTTGCAGG - Intergenic
912991466 1:114491422-114491444 TTTTGTGACCGGAGGCTTGCAGG - Intronic
913350195 1:117849722-117849744 TGTTGTGACCAGAGGCTCACAGG - Intergenic
914752215 1:150542612-150542634 AATCCTGACCAGAGTCTTGTTGG + Intergenic
915503024 1:156332924-156332946 AAGTGTGACCAGAGGCTTATAGG + Intronic
916157004 1:161862074-161862096 TATTGTAACCAGAGGCTTGCAGG + Intronic
916478009 1:165187873-165187895 CATTGTGGCTAGAGGCTTATGGG + Intergenic
917760448 1:178151486-178151508 TGTTGTGACCAGAGGCTTACAGG + Intronic
917800677 1:178566807-178566829 TGTTGTGTCCAGGGGCTTGTAGG - Intergenic
918089180 1:181273567-181273589 TGTTGTGACCAGAGGCTCTCAGG + Intergenic
918201096 1:182267642-182267664 AAATGTGGCCAGCGGCTTGTGGG - Intergenic
921645274 1:217607631-217607653 TGTTGTGACCAGAGGCTTCCAGG + Intronic
921668836 1:217904490-217904512 AGTTATGACCAGAGGCTTGCAGG + Intergenic
924062957 1:240195584-240195606 AAATGTGACCAGGGGCTTGCAGG + Intronic
924128841 1:240884326-240884348 AAATGTGACCAGGGGCTTGCAGG + Intronic
924693453 1:246375176-246375198 TGTTGTGACTAGAGGCTTTCAGG + Intronic
1062776519 10:153728-153750 TGTTGTGACCAGAGGCTCACAGG - Intronic
1063086816 10:2827109-2827131 TATTGAGACCAGAGGCTTTCAGG - Intergenic
1063652396 10:7951085-7951107 TGTTGTGACCAGAGACTTATAGG + Intronic
1064395870 10:14981606-14981628 CATTCTGACCAGAGGCTCTTTGG + Intronic
1064397566 10:14993793-14993815 CATTCTGACCAGAGGCTCTTTGG + Intergenic
1064432392 10:15282468-15282490 TGTTGTGACCAGAGGCTTGCAGG + Intronic
1064450687 10:15439608-15439630 AGTTGTGTCCAGAGGGTTGTTGG - Intergenic
1065275825 10:24084819-24084841 TATTTTGGTGAGAGGCTTGTCGG - Intronic
1065648504 10:27863032-27863054 TGTTGTAGCCAGAGGCTTGCAGG - Intronic
1067138856 10:43637828-43637850 TATTGTGACTAGAAGCTTGTAGG - Intergenic
1068631156 10:59298938-59298960 TAGGGTTACCAGAGGCTGGTGGG + Intronic
1068691603 10:59921346-59921368 TAATGTGACCAGAAGCTTATTGG + Intergenic
1068768806 10:60797518-60797540 TATTGTGAGCACATACTTGTAGG + Intergenic
1069075972 10:64038833-64038855 TATTGTGACCATATGTGTGTAGG + Intergenic
1069401571 10:68053201-68053223 TGTTCTGACCAGAGGCTTGCAGG - Intronic
1069653258 10:70067163-70067185 TGTTGTGACCAGAGGCTTGTAGG + Intronic
1070442214 10:76457768-76457790 TGTTGTGACCAGAGGCTTTCAGG + Intronic
1071181882 10:82995686-82995708 TATTCTGATCATAGGCTTGAGGG - Intergenic
1071755283 10:88531105-88531127 TATTGGGACCAGTGGCTTTAGGG - Intronic
1072069405 10:91901839-91901861 TGTTGTGACCAAAGGCTCATAGG - Intergenic
1073745481 10:106463594-106463616 TTTTGTGACCAGAGGCCTACAGG - Intergenic
1075175310 10:120155075-120155097 GCTTGTGACCAGAGGCTCATGGG + Intergenic
1075542473 10:123326727-123326749 TGTTGTGCCCAGAGGCTGGCAGG + Intergenic
1076978596 11:193399-193421 TATTATGACCAGAGGCTTGAAGG - Intronic
1078513995 11:12008041-12008063 TATTGTCAGCAGAGGTTTGCAGG - Intronic
1078793395 11:14568039-14568061 AAATGTGACCAGAGGCTTGCAGG + Intronic
1080698999 11:34628390-34628412 TATTTTGAGAAGAGGCCTGTAGG + Intronic
1081116742 11:39211903-39211925 TGTTGTGACCAGAGGCTCGCAGG + Intergenic
1081321887 11:41701523-41701545 TAGTGTGACCCAAGGCTTTTAGG - Intergenic
1081730199 11:45366542-45366564 TTTTGTGACCAGAGAATGGTTGG + Intergenic
1081923946 11:46807204-46807226 TGTTGTGACCAAAGGGTTGCAGG + Intronic
1084741646 11:71143807-71143829 ACATGTGACCAGGGGCTTGTAGG + Intronic
1084807175 11:71587096-71587118 CATTCTGACCAGAGGCTCTTTGG - Intronic
1084811195 11:71612658-71612680 CATTCTGACCAGAGGCTCTTTGG - Intergenic
1084844256 11:71887105-71887127 CATTGTGACCAGAGGCTCAATGG - Intronic
1084847113 11:71909563-71909585 CATTCTGACCAGAGGCTCTTTGG - Intronic
1085320954 11:75573620-75573642 GATTGTGACCTGGGGGTTGTTGG + Intergenic
1085924051 11:80993207-80993229 TGTTGTGACCAGATGCTCATAGG + Intergenic
1086623424 11:88915978-88916000 TATTGTGACCATAGCCTTTCAGG - Intronic
1086920311 11:92579347-92579369 AATTATGACCAGAGGATTATAGG + Intronic
1087072260 11:94092826-94092848 TATTGTGACCAGAGGTTTGCAGG + Intronic
1087956614 11:104296211-104296233 TGTTATGACTAGAGGCTTGCAGG - Intergenic
1087976491 11:104555294-104555316 TGTTGTTCCTAGAGGCTTGTAGG + Intergenic
1088174790 11:107040351-107040373 TGTTGTGACCAGAAGCTTGCAGG - Intergenic
1088525375 11:110747330-110747352 TATTATGGTCAGAGGTTTGTAGG - Intergenic
1088770481 11:113031083-113031105 TATTGTGGCCAGAGGCTCCCAGG - Intronic
1089913791 11:122131150-122131172 AAATGTGGCCAGAGGCTTTTAGG - Intergenic
1090219158 11:125000870-125000892 TGGTATGACCAGAGGCTTGCAGG - Intronic
1090382952 11:126339512-126339534 TCTCTTGACAAGAGGCTTGTGGG + Intronic
1090974959 11:131672647-131672669 TATTGGCACCAGAGTCTAGTGGG - Intronic
1092432737 12:8422019-8422041 CATTCTGACCAGAGGCTCTTTGG + Intergenic
1092435333 12:8442657-8442679 CATTCTGACCAGAGGCTCTTTGG + Intergenic
1092973234 12:13719031-13719053 TCTTGTGACAACAGGCATGTGGG - Intronic
1093504526 12:19849794-19849816 TGTTGTGACCAGAGGCTGGAAGG + Intergenic
1093609816 12:21140095-21140117 TATTGTGACCAGAGGCAGACAGG + Intronic
1093912895 12:24767562-24767584 TACTGTGACCAGAGGCTTGCAGG + Intergenic
1094406266 12:30119427-30119449 AAATGTGACCAGAAGCTTGCAGG - Intergenic
1096209607 12:49754533-49754555 TGTTGTGACCTTAGGCTTGCAGG + Intronic
1097349227 12:58529534-58529556 AAGTGTGACTAGAGGCTTGCAGG + Intergenic
1097657345 12:62383243-62383265 TGTTGTGAACAAAGGCTTGGAGG - Intronic
1098135549 12:67397994-67398016 TATTTTGAGCAGAGGCTGGTGGG + Intergenic
1098221607 12:68275646-68275668 CATCGTGACCAGAGGCTTGCAGG - Intronic
1098988593 12:77040098-77040120 TATTGTAACCAGAGGCTCACAGG - Intronic
1099378291 12:81921495-81921517 TAAAATGACCAAAGGCTTGTTGG + Intergenic
1100662941 12:96720039-96720061 TGTTGTGACCAGAGGCTCTCGGG + Intronic
1100873788 12:98941083-98941105 TATTGTGACCAGAGGCTTGCAGG - Intronic
1101584123 12:106069644-106069666 TATTGTGAGCAGAGGCTCTCAGG + Intronic
1103133407 12:118487764-118487786 TGTTGGGGCCAGAGGCTTGAGGG + Intergenic
1103883583 12:124184966-124184988 TATTGTGCCTAGAGGCCTGCAGG + Intronic
1104389639 12:128380787-128380809 TGTTATGACCAGAGGCTTGTAGG - Intronic
1106467875 13:30028833-30028855 TATTTTAACCAGAGCCTGGTTGG - Intergenic
1106749519 13:32746393-32746415 TGTTGTGGCCAGGGGCTTGAAGG - Intronic
1106785288 13:33101561-33101583 TATTGTGACCTGAGGCTCACAGG + Intergenic
1107606946 13:42067092-42067114 TGTTGTGACCAGAGGTTTGCAGG + Intronic
1108067938 13:46597865-46597887 TTTTGTGACCAGAGGCTTGCAGG + Intronic
1108117326 13:47143666-47143688 TGTTGTGACCAGTGGTTTGTAGG - Intergenic
1108498579 13:51048041-51048063 TCTTGTGACCAGAGACTTTCAGG + Intergenic
1108773135 13:53730214-53730236 TTTTGTGACCAGAAACATGTAGG - Intergenic
1110443061 13:75546920-75546942 TATTGTGACCACAGGCTCACAGG - Intronic
1110643459 13:77853521-77853543 TAATTTGACCAAAGGCTTCTTGG + Intergenic
1111265793 13:85811408-85811430 TACTGTGACCAGAGGCTGGCAGG + Intergenic
1111271180 13:85888236-85888258 AAATGTGACCAGAGGCTTGCAGG + Intergenic
1111903225 13:94225752-94225774 AAACGTGACCAGAGGCTTGCAGG + Intronic
1111910459 13:94305244-94305266 TGTTGTGCCCAGTGGCTTGCAGG - Intronic
1111921655 13:94418367-94418389 TGTTATGACCAGAGGCTTGTAGG + Intergenic
1112121549 13:96417866-96417888 TACTGTGACTGGAGGCTTGCAGG - Intronic
1112598154 13:100828972-100828994 TATTATGACCAGAGGCTTGTAGG - Intergenic
1112886191 13:104175109-104175131 TGTTGTGGCCAGAGGCTTGCAGG + Intergenic
1113336435 13:109380899-109380921 TATTGTGACCAGAGTCTTGAAGG + Intergenic
1113463902 13:110500695-110500717 TCTTGTGAGCAGAGGCTTGCAGG - Intronic
1115792022 14:36890459-36890481 TATTGAGAGTAGAGGCTTGTTGG + Intronic
1116971434 14:51070358-51070380 TTTTGTGACCAGAGGCTCACAGG + Intronic
1117038456 14:51749667-51749689 CATTCTGACCAGAGGCTCTTTGG - Intergenic
1118321895 14:64758184-64758206 TATTGTGGCCAGTGTCCTGTGGG + Intronic
1118522469 14:66600472-66600494 TGTTGTGACCAGAGGCTTACAGG - Intronic
1118735134 14:68695697-68695719 CAGGGTGACCAGAGGCTTGTGGG - Intronic
1121161156 14:91742442-91742464 GATAGTTACCAGAGGCTTGTAGG + Intronic
1121255878 14:92529980-92530002 TGTTGTGACCAGACGCTTGCAGG + Intronic
1121579032 14:95012598-95012620 AAACGTGACCCGAGGCTTGTAGG - Intergenic
1121752640 14:96370410-96370432 TATTTTGACAAGAGACTTGATGG - Intronic
1123026654 14:105427578-105427600 TGTTGTGACCAGAGGCTCGTAGG + Intronic
1127145354 15:56017621-56017643 TATTGTGACCGGAGGCTCCCTGG - Intergenic
1127809632 15:62552811-62552833 TTTTGTGATCAGAGGCTTGTAGG + Intronic
1128485893 15:68088311-68088333 CGTTGTGACCAGGGGCTTGCAGG + Intronic
1129125171 15:73433950-73433972 TGTTGTGACCAGAGGCTCACGGG - Intergenic
1129815571 15:78550187-78550209 AAATGTGACCAGTGGCTTGTAGG - Exonic
1130013283 15:80168994-80169016 TTTTCTGACCAAAGGCTTGAAGG + Intronic
1130747976 15:86676415-86676437 TTTTGTGACCATAAGCTTATTGG - Intronic
1131192515 15:90328296-90328318 TATTGTGACCAGAGGCTTACAGG - Intergenic
1131381967 15:91971758-91971780 TGTTGTGAACAGAGGCTCGCAGG + Intronic
1131638495 15:94263374-94263396 TATTGTGGCCAGAGGCTGAAAGG - Intronic
1131968534 15:97870272-97870294 TAATGTGAGCAGAGACCTGTTGG - Intergenic
1131988653 15:98070046-98070068 TATTGTGACCAGAGGCTCACAGG - Intergenic
1132333480 15:101028202-101028224 TGTGGTGACCAGAGGCTCGCAGG - Intronic
1134363885 16:13558470-13558492 TGTTGTGGTCAGAGGCTTGCAGG - Intergenic
1134780846 16:16893996-16894018 TATTTTGACCAGAGGCCAGTAGG - Intergenic
1135300685 16:21324258-21324280 AAATGTGACCAGAGGCTTGCAGG + Intergenic
1135861164 16:26057415-26057437 TGTTTTGACCAAAGGCATGTAGG + Intronic
1137262139 16:46839833-46839855 AAACGTGACCAGAGGCTTGCAGG - Intergenic
1137723839 16:50643690-50643712 TGTTGTGACCAGAAGCTGGCAGG - Intergenic
1137759688 16:50930320-50930342 CACTGTGACCAGAGGCTTGAAGG + Intergenic
1138631501 16:58298123-58298145 TGTTGTGACCAGAGGCTTTCAGG - Intronic
1140244983 16:73239929-73239951 CATTGTGACCAGAGGCTTGCAGG - Intergenic
1140957769 16:79881674-79881696 AAATGTGATCAGAGGCTTGCAGG + Intergenic
1142466027 17:137890-137912 TATTATGACCAGAGGCTTGAAGG - Intronic
1142791991 17:2273849-2273871 TGTTGTGATCAGAGGCTTGAAGG + Intronic
1144277922 17:13693363-13693385 TATTGTCACCAGAAGTTTGTAGG + Intergenic
1144289117 17:13808543-13808565 TATCGTGACCAGAAGTTTGCAGG - Intergenic
1144561371 17:16323094-16323116 TATTGTGGCCAAAGGCTTGGAGG + Intronic
1145118048 17:20230167-20230189 TGTTGTGACCAGAGGCTTGCAGG + Intronic
1145289513 17:21532186-21532208 TATTGCAACCAGAGGCTTGCAGG + Exonic
1146026014 17:29321624-29321646 TATTGTGATCAGAGGCTCGAAGG - Intergenic
1146296941 17:31657774-31657796 TGTTGTGACCAGAGGCTTGTGGG + Intergenic
1148729529 17:49824133-49824155 ATATGTGACCAGAGGCTTGCAGG + Intronic
1149072723 17:52562137-52562159 TATTGTGACAAGAGTGTTGACGG + Intergenic
1149426496 17:56559553-56559575 TCTTGTGACCAGAGGCTTGCAGG - Intergenic
1151617391 17:75222629-75222651 AAATATGACCAGAGGCTTGCAGG - Intronic
1152060821 17:78073689-78073711 TGTTGTGAGCAGAGGCTCATAGG - Intronic
1152171310 17:78750889-78750911 AAGTGTGACCAGAGGTCTGTAGG - Intronic
1152289875 17:79433841-79433863 TTTTGCGACCAGAAGCTTGCAGG - Intronic
1153138760 18:1947784-1947806 TGTTGTGACCAGAAGCTTGCAGG - Intergenic
1154995242 18:21634432-21634454 AAATGTGACTAGAGGCTTGCAGG - Intergenic
1155290174 18:24332616-24332638 TGTTGTGACCCAAGGCTTGCAGG + Intronic
1155647593 18:28098417-28098439 TCTTGTGACCAGAGGCTCATAGG - Intronic
1156019584 18:32584567-32584589 TGTTGTGACCAGAGGCTCTTGGG - Intergenic
1156871085 18:41945761-41945783 TGTTGTGACCAGAGGCTTGCAGG - Intergenic
1157572117 18:48720016-48720038 TGTTGTGACCAGAGGCTTGCAGG + Intronic
1158057605 18:53300633-53300655 TATTGTAACCAGAGGCTTGAAGG + Intronic
1158210141 18:55039997-55040019 TGAAGTGTCCAGAGGCTTGTAGG + Intergenic
1158691103 18:59661588-59661610 TATTGTGGCCAGAGGCTTATGGG - Intronic
1159115282 18:64106441-64106463 TATTGGAACCAGAAGCTTCTAGG - Intergenic
1160625168 18:80199189-80199211 TGTTGTGACCAGAGGCTAACAGG - Intronic
1164572441 19:29384204-29384226 TATTTGGGCCAGAGGCTTGGAGG - Intergenic
1166579104 19:43877315-43877337 AATTGTGACCAGCTGTTTGTGGG - Intronic
1167141782 19:47656446-47656468 CATTGTGGCCAGAGGCTTTCAGG + Intronic
1167167838 19:47811408-47811430 TAGTGTGAGCAGAGCCTTGTGGG + Intronic
1167525499 19:49981215-49981237 TCGTGTGGCCAGAGGCTTGCAGG - Intronic
1167701839 19:51053040-51053062 GATTGTGACCAGAGGCTCGAAGG + Intergenic
925298580 2:2794222-2794244 TGTTGTGACCAGAATCTTGCAGG + Intergenic
927292377 2:21417335-21417357 TATTTTCATCAGAGGTTTGTGGG - Intergenic
928494413 2:31817477-31817499 GATAGTTACCAGAGGCTTGGAGG - Intergenic
928948823 2:36796343-36796365 TGTTGTGACCAGAGGCTCACAGG + Intronic
928997754 2:37312817-37312839 AAATGTGACCAGAGGCTTGCAGG + Intronic
929764716 2:44834504-44834526 AAATGTGGCCAGAGGCTTGCAGG - Intergenic
930188567 2:48434681-48434703 TGTTGTGACCAGAGGCTCACAGG - Intergenic
930377417 2:50585350-50585372 GATGGTTACCAGGGGCTTGTGGG + Intronic
930760847 2:55034062-55034084 TATTATGACAAGAGGCTTACAGG + Intronic
931053618 2:58442148-58442170 TATTTTCACCAGAAGCTTGTTGG - Intergenic
931428567 2:62192485-62192507 TGAAGTCACCAGAGGCTTGTGGG - Intergenic
931483615 2:62668522-62668544 AAATGTGACAAGAGGCTTGCAGG + Intergenic
931598898 2:63982493-63982515 TATTGTGACCAAAGGCTCGCAGG - Intronic
931627061 2:64266046-64266068 TGTTGTGACCAGAGGTTCATAGG - Intergenic
932349592 2:71021474-71021496 CATTCTGACCAGAGGCTCTTTGG - Intergenic
932477521 2:72015892-72015914 CATTGTGATCAGAGGCTCATAGG - Intergenic
932932840 2:76062602-76062624 TATTGTGACATGAGGCCTTTAGG + Intergenic
933859605 2:86452425-86452447 AAATGTGACCAGAGGCTTGAAGG + Intronic
934539679 2:95163377-95163399 TCTTGGGCCCAGAAGCTTGTAGG - Intronic
934702621 2:96454248-96454270 AAATGTGACCAGAGGCTTGCAGG - Intergenic
934917952 2:98316061-98316083 TATGGTGACCAGCGGCCTGCAGG - Intergenic
935680449 2:105631638-105631660 AAATGTGACCAGAAGCTTGAAGG + Intergenic
936140150 2:109932466-109932488 TACTGTGACCAGAGACTTGCAGG + Intergenic
936171048 2:110175070-110175092 CATTGTGACCAGAGGCTCACAGG + Intronic
936176839 2:110230411-110230433 TACTGTGACCAGAGACTTGCAGG + Intergenic
936204546 2:110439020-110439042 TACTGTGACCAGAGACTTGCAGG - Intronic
936440252 2:112545443-112545465 AAATGTGACCAGAGGCTCGCAGG + Intronic
936441052 2:112553763-112553785 TGTTATGACCAGAGACTTGCAGG + Intronic
936441901 2:112561575-112561597 TGTTGTAACCCGAGGCTTGAAGG - Intronic
936754235 2:115686428-115686450 TGTTGTGACCAGAGGCTCACAGG + Intronic
936903777 2:117513590-117513612 TATTTTGCCCAGAGGATTCTGGG + Intergenic
937330557 2:121025531-121025553 TATTGTGACCAGAAGCTTAGGGG + Intergenic
937424662 2:121788868-121788890 TCTTGTGAGCAGAGGCTTGCAGG + Intergenic
938735173 2:134179432-134179454 TGTTGTGACCAGGGGCTCGCGGG + Intronic
938837011 2:135114581-135114603 AAATGTGACCAGAGGCTCGAAGG - Intronic
939165085 2:138631929-138631951 AATTGTGACCAGAGGCTCACAGG - Intergenic
940209450 2:151241552-151241574 AAATATGACCAGAGGCTTGTGGG - Intergenic
940682372 2:156803342-156803364 AATTCTGACCAGGTGCTTGTGGG - Intergenic
940871859 2:158867258-158867280 CATTCTGACCAGAGGCTCTTTGG - Intergenic
940874079 2:158883245-158883267 CATTCTGACCAGAGGCTCTTTGG - Intergenic
942361731 2:175180107-175180129 TATCTCGACCAGAGGCTAGTAGG - Exonic
943040922 2:182803952-182803974 AAATGTGACCAGAGGCTTGCAGG - Intergenic
943700415 2:190983188-190983210 TGTTGTGACCAGAGGCTTGAAGG + Intronic
944270308 2:197776446-197776468 TATTGTGACCAGAGGTTCTTGGG + Intronic
944748664 2:202684801-202684823 TGTTGTGATTAGAGGCTTATAGG + Intronic
945141201 2:206688152-206688174 TATTGTGGCCAGAGGCTTGCAGG - Intronic
945371821 2:209027969-209027991 TATTGTGACCAGAGGCTTATAGG - Intergenic
945372860 2:209041868-209041890 AAATGTGACCAGAGGTTTGAAGG + Intergenic
947788595 2:232848097-232848119 TATTGTGACTAGAAGTTTATGGG - Intronic
948014772 2:234679161-234679183 TGTTGTGACCAGAGACTCATAGG - Intergenic
1169516646 20:6323255-6323277 TATTGTGACCAGAGTCTGACAGG - Intergenic
1170234868 20:14091308-14091330 TATGGTTACCAGAGGCTGGAGGG + Intronic
1170746290 20:19102061-19102083 TGTTGGGATCAGAGGCTTGCAGG - Intergenic
1171106107 20:22434383-22434405 TGTTGTGACCAGAGGCTTGCAGG + Intergenic
1172497774 20:35401110-35401132 TGTTGTGACCAGAGGCTTCCAGG - Intronic
1173655109 20:44694794-44694816 GATTCTGACCAGAGCCTGGTGGG + Intergenic
1174135729 20:48377671-48377693 TATTGTGACCACAGGCTCATGGG - Intergenic
1174227232 20:49011258-49011280 TGTTCTGACCAGAGACTTGCAGG + Intronic
1174294353 20:49534368-49534390 AATTGGGACCAGAGGCATGTGGG - Intronic
1174726662 20:52869734-52869756 AAATGTGACCAGAGGCTTATAGG - Intergenic
1175028168 20:55925264-55925286 TATTGTGACTAGAGGCTCTTAGG - Intergenic
1177911167 21:27034079-27034101 TAGTCTGACCAGAGCATTGTAGG - Intergenic
1178048239 21:28720247-28720269 TACTGTGACCAGAGGCTCCTGGG + Intergenic
1179050122 21:37881936-37881958 ATTTGTGACCAGAGACTTGGGGG + Intronic
1179057582 21:37950337-37950359 TATTGTGACCAGAGGCTCGCAGG - Intergenic
1179213183 21:39343740-39343762 TGTTGTGATCAGAGGTTTGTAGG + Intronic
1180234687 21:46450829-46450851 TATTGGGATCAGAGTCTTGGGGG - Intergenic
1180799964 22:18627171-18627193 TTTTGGAACCAGAGGCTTGGCGG - Intergenic
1181221751 22:21368095-21368117 TTTTGGAACCAGAGGCTTGGCGG + Intergenic
1181637118 22:24179698-24179720 TTTTGGAACCAGAGGCTTGGTGG + Intergenic
1181780878 22:25192276-25192298 TTTTGTGACCTTAGGCTTCTAGG + Intronic
1182743447 22:32586297-32586319 TATTGTGACCAGAGGCTTAAAGG - Intronic
1182948306 22:34346156-34346178 TATTGTGACCACAGACTTGTAGG - Intergenic
1183575591 22:38686736-38686758 TATTGTGAAGACAGGCTTCTTGG - Exonic
1184367393 22:44060881-44060903 TGTTGTGACCAGAGGCTCGCAGG - Intronic
1184939475 22:47751117-47751139 TATTTTTACCACAGCCTTGTGGG - Intergenic
950769007 3:15296036-15296058 TGTTGTGACCAGAGGCTCTCAGG + Intronic
950939798 3:16882329-16882351 GCGTGTGACCAGTGGCTTGTGGG + Intronic
952056711 3:29455493-29455515 AGTTGTGATCAGAGGCTTGTGGG - Intronic
953722374 3:45367719-45367741 TGTTATGACTAGAGGCTTGCAGG - Intergenic
955472812 3:59303627-59303649 TATTGGGACACGAGGCTTGAAGG + Intergenic
956186175 3:66564357-66564379 TGTTGTGACCACAGGTTTGCAGG - Intergenic
956385758 3:68717324-68717346 TATTCTGACCAGAGCCTGGTAGG + Intergenic
957044735 3:75364835-75364857 CATTCTGACCAGAGGCTCTTTGG + Intergenic
957076518 3:75607022-75607044 CATTCTGACCAGAGGCTCTTTGG + Intergenic
957502400 3:81074094-81074116 TGTTATGACCAGAGACTTGCAGG - Intergenic
957965380 3:87315926-87315948 TGTTATGACCAGAGGCTTATAGG + Intergenic
959417041 3:106088006-106088028 TGTTGTGACCAGAGGCTCTCAGG + Intergenic
959927731 3:111942934-111942956 TATTGTGACTAGAGGCTTGCAGG + Intronic
960366196 3:116775830-116775852 TGTTGTGACCAGAGGCTTCCGGG + Intronic
960464696 3:117983087-117983109 GATTGTGAACAGAGGCTTAATGG - Intergenic
960505139 3:118484021-118484043 TATTGTGACCAGAGGCTCCTAGG + Intergenic
961271928 3:125695926-125695948 CATTCTGACCAGAGGCTCTTTGG - Intergenic
961396753 3:126598876-126598898 TGTGGTTACCAGAGGCTTGGGGG + Intronic
962062925 3:131950136-131950158 TATTGTGACCAGAAGTTTTTAGG - Intronic
962092968 3:132264415-132264437 TGTTGTGACCAAAGGCTTGCAGG - Intronic
962694978 3:137939153-137939175 TATGGTAACCAGTGGCTTGAGGG - Intergenic
962700768 3:137998250-137998272 TGTTGTGACCAGAGGCTTGCAGG + Intergenic
963834451 3:150042484-150042506 TATTGTGACCAGAGGCTCACAGG - Intronic
964205441 3:154169838-154169860 TATTGTGACCAGAGGCTTGTAGG + Intronic
964364596 3:155935962-155935984 TATTACAACCAGAGGCTTGCAGG + Intronic
964504953 3:157389067-157389089 AAATGTAACCAGAGGCTTGCAGG - Intronic
965136456 3:164777529-164777551 TGTTGTGACCAGAGGCTCACAGG - Intergenic
965447766 3:168797056-168797078 TAATGTGACCAGAGGTTTAGGGG + Intergenic
965707860 3:171527372-171527394 TGTTGGGATCAGAGGCTTGCAGG + Intergenic
966400787 3:179545022-179545044 TATTGTGACCAGAAGCTTAGAGG + Intergenic
967138812 3:186535526-186535548 AAATGTGACCAGAGGCTTACAGG + Intergenic
968988997 4:3896075-3896097 CATTCTGACCAGAGGCTCTTTGG + Intergenic
969019973 4:4133317-4133339 CATTCTGACCAGAGGCTCTTTGG + Intergenic
969215404 4:5718228-5718250 TGTTGTGACCAGAGGCTTGTAGG - Intronic
969788727 4:9477385-9477407 CATTCTGACCAGAGGCTCTTTGG - Intergenic
969793466 4:9508153-9508175 CATTCTGACCAGAGGCTCTTTGG - Intergenic
969826354 4:9761518-9761540 CATTCTGACCAGAGGCTCTTGGG - Intergenic
970141906 4:12992169-12992191 TGTTGTAACCAGAGGCTTGAAGG - Intergenic
970640495 4:18059831-18059853 AAATGTGACCAGAGGCTTTCAGG - Intergenic
970677831 4:18472828-18472850 TATTGTGACCAGAGACTCAAGGG + Intergenic
971235768 4:24840891-24840913 TGTTGTGACCAGAGGCTTCCAGG + Intronic
971427186 4:26527871-26527893 TGTTGTGACCAGAGGCCTGCAGG + Intergenic
971427262 4:26528802-26528824 TGTTGTGACCAGAGGCCTGCAGG - Intergenic
971526065 4:27620645-27620667 TACTCTGACCAGAGACTTTTGGG + Intergenic
972276389 4:37561762-37561784 TATTGTGACCAGAGGCTTCTAGG - Intronic
972639743 4:40914652-40914674 TGTTGTGACCAGAGGCTTGCAGG + Intronic
972764252 4:42136924-42136946 TGTTGTGAGCAGAGGCTCTTAGG + Intronic
972854150 4:43086000-43086022 TGCTGTGACCAGAGGCTTACAGG - Intergenic
974460565 4:62182020-62182042 TATTGTGACCAGAGGTTCACAGG - Intergenic
975564567 4:75740238-75740260 AAATGTGATCAGAGGCTTGCGGG + Intronic
975846142 4:78527141-78527163 TGTTGTGAACAGAGGCTCATAGG + Intronic
976050520 4:81007232-81007254 TATTGTGGCCAGAGGCTCCCAGG - Intergenic
978389486 4:108210081-108210103 TGTTGTGACCAGAGGCTTGAAGG + Intergenic
978484011 4:109229345-109229367 TGTTGTAACCAGAGGCTTACAGG - Intronic
978574236 4:110172389-110172411 TGTTGTGACCAGACACTTGTAGG + Intronic
978608569 4:110510256-110510278 TATTGTGACCATGGACTGGTGGG + Exonic
978751752 4:112256891-112256913 TATTGTGATCAGAGGCTTGCAGG - Intronic
978786437 4:112615062-112615084 TGTTCTGACCACAGGCTTGCAGG + Intronic
978874858 4:113627424-113627446 TGTTGTGACTAGGGGCTTGCAGG - Intronic
980823140 4:138041901-138041923 AGTTGTGACCAGAGGTTTGCAGG - Intergenic
981797080 4:148607659-148607681 TGTTGTGACCAGAGACTCATGGG - Intergenic
983299341 4:165905239-165905261 TATTGTGAATAAAGGTTTGTAGG - Intronic
983609359 4:169625878-169625900 TTCTGTGACCAGATGCTTGGGGG + Intronic
983863949 4:172740964-172740986 AAGTGTGACCAGAGGCTTGCAGG + Intronic
984021794 4:174494302-174494324 TTTTGTGACCAGAGGCTTTCAGG + Intronic
984312572 4:178081755-178081777 AAATGTGACCAGAGGCTTACAGG - Intergenic
984883841 4:184432643-184432665 TATTGTGACCAGTAGCTCGCAGG + Intronic
985867593 5:2527018-2527040 AAATATGACCAGAGGCTTGCAGG + Intergenic
986599120 5:9453670-9453692 TATGGTGACCAGAGGCTCGCAGG + Intronic
986840704 5:11693864-11693886 CATTGTGACCAAAGGCTTGCAGG - Intronic
986859447 5:11909511-11909533 TATTCTTACCAGAGGCATGGAGG - Intergenic
987004716 5:13698447-13698469 TGTTGTGACCGGAGGCTTGCAGG - Intronic
987394651 5:17411181-17411203 TGTTGTGACCAGATGCTCTTAGG + Intergenic
988408472 5:30855272-30855294 TATTGAGAGTAGAGGATTGTGGG - Intergenic
989329890 5:40244645-40244667 AAATGTGACCAGAGGCTTATAGG - Intergenic
990441571 5:55851165-55851187 TGTTGTGACCAGAGGCTCACAGG - Intergenic
990488567 5:56282394-56282416 TGTTGTGACCAGAGGCTGGAAGG + Intergenic
991392475 5:66161738-66161760 AAATGTGACCAGAGGCTTGTAGG + Intronic
992524057 5:77588721-77588743 TATTGTGACTGGAGGCTTTCAGG - Intronic
993464800 5:88231811-88231833 TGTTATGACCAGAGGCTCGCAGG - Intronic
993554905 5:89324242-89324264 GGTGGTTACCAGAGGCTTGTTGG - Intergenic
993936092 5:94004748-94004770 AAATGTTACTAGAGGCTTGTAGG - Intronic
994833168 5:104811615-104811637 TGTTGTGACCAGAGGCTCTCAGG - Intergenic
995407731 5:111819630-111819652 TGTTATGACCAGAGGCTTGCAGG - Intronic
996665351 5:126052672-126052694 AAATGTGACCAGCGGCTTGCAGG + Intergenic
996768335 5:127058480-127058502 TATTATGACCAGAGACTCATAGG + Intronic
997168121 5:131683866-131683888 AAATGTGACCAGAGGCTCATAGG - Intronic
997203370 5:132026369-132026391 TATTCTGCCCAGAGGCCTGGAGG - Intergenic
998371236 5:141662991-141663013 TATTGTAACCAGAGGCTAGCAGG + Intronic
998563699 5:143196438-143196460 TGTTGTGACCAGGGGCTTACAGG - Intronic
999469998 5:151846038-151846060 TATTGTTACCAGAGGCTCTTGGG + Intronic
999725297 5:154431761-154431783 TGTTGTGATCAGAGGCTTGCAGG - Intergenic
1000020383 5:157313197-157313219 TGTTGTGACCAGAGGCTCACAGG - Intronic
1000340445 5:160273207-160273229 TGTTGTGATCAGAGCCTTGCAGG - Intronic
1000362663 5:160462311-160462333 TGTTGTGACCAGAGGGTTGGAGG - Intergenic
1000507407 5:162138328-162138350 GATTTTGACCAAAGGCTTGCAGG - Intronic
1001350436 5:170957903-170957925 TGTTGTCACCAGAGGCTTGCAGG + Intronic
1001449211 5:171811117-171811139 TATTGTGACCAGAGGCTTGCAGG - Intergenic
1001549163 5:172589824-172589846 TGTTGTGACCAGAGGCTGAAAGG + Intergenic
1001942265 5:175749166-175749188 TCTTGTCACCAGAGGTTTGCAGG + Intergenic
1002177113 5:177407204-177407226 TGTTGTGACCAGAGGCTCACAGG + Intronic
1002923565 6:1591371-1591393 AAATGTGACCAGAGGCTTGCAGG + Intergenic
1003354721 6:5356710-5356732 AAATGTGACCAGAGGCTCGCAGG + Intronic
1005626466 6:27667140-27667162 TACTCTGTCCTGAGGCTTGTTGG - Intergenic
1006872032 6:37260105-37260127 TCCTATGACCAGAGGCTTGTGGG - Intronic
1006900465 6:37497287-37497309 TGTTGTGTCCATAGGCTTGCAGG - Intronic
1007474611 6:42110578-42110600 TCTTGTGACCAGAGGCTCATAGG - Intronic
1008129965 6:47710129-47710151 TGTTGTAAGCAGAAGCTTGTAGG + Intronic
1008540122 6:52538919-52538941 AAATGGGACCAGAGGCTTGCAGG - Intronic
1009059653 6:58383263-58383285 TGTTGTGACCAGAGGCTTTCAGG + Intergenic
1009231255 6:61064139-61064161 TGTTGTGACCAGAGGCTTTCAGG - Intergenic
1009272571 6:61632801-61632823 TATTGTGACCTGAGATCTGTGGG - Intergenic
1009671553 6:66759165-66759187 TGTTGTGACCAGAGACTTTCAGG - Intergenic
1009852437 6:69214604-69214626 TACGGTGAGCAGAGTCTTGTTGG + Intronic
1011232011 6:85172760-85172782 AAATGTGACCAGAGATTTGTTGG - Intergenic
1012614835 6:101264059-101264081 TTTTGTGACTGGAGGCTTCTAGG + Intergenic
1012713524 6:102638757-102638779 TATTTTGTGCATAGGCTTGTTGG + Intergenic
1013737333 6:113242812-113242834 TATAAGGATCAGAGGCTTGTTGG - Intergenic
1014677780 6:124389107-124389129 TGTTGTAACCAGAGGCTTATAGG + Intronic
1014686934 6:124513430-124513452 TATTGTATCCAGAGGCTATTAGG + Intronic
1015438541 6:133219762-133219784 TATTGTGACCAGAGACTTGTAGG + Intergenic
1015595474 6:134862078-134862100 CATTGTGACCAGAGACTTGCAGG - Intergenic
1015934819 6:138398308-138398330 TACTGTGACCAGAGGCTTACGGG + Intergenic
1016045701 6:139478270-139478292 TGTTGTGACCAGAGGCTCAAAGG - Intergenic
1016158723 6:140848470-140848492 TATTGTAACCAGAGGCTTGAGGG - Intergenic
1016283270 6:142444333-142444355 TATTAAGCCCATAGGCTTGTGGG + Exonic
1017237847 6:152135914-152135936 CATTGTGACCAGAGTGTAGTCGG - Intronic
1017722624 6:157254506-157254528 AAATGTGACCAGAGGCTTGCAGG - Intergenic
1017823120 6:158063110-158063132 AAATGTGACCAGAGGTTTGCAGG + Intronic
1018406928 6:163495277-163495299 AAATGTGACCAGAGGTTTGTGGG + Intronic
1018603353 6:165570873-165570895 AAATGTCACCAAAGGCTTGTAGG - Intronic
1020307380 7:6845352-6845374 CATTCTGACCAGAGGCTCTTTGG + Intergenic
1020311852 7:6874178-6874200 CATTTTGACCAGAGGCTCTTTGG + Intergenic
1020711385 7:11609664-11609686 TATTGTGACCACAGGCAGGGAGG + Intronic
1021829641 7:24591705-24591727 TACTGTGACTAAAGGCTTGCAGG - Intronic
1022180703 7:27916422-27916444 TGTTGTGGCCAGAGGCTTGCAGG - Intronic
1022285242 7:28950452-28950474 AAATGTGACCAGAGGCTTGCAGG + Intergenic
1022402575 7:30053852-30053874 TTTTGTGACCAAAGTCTTGCAGG - Intronic
1022427306 7:30281713-30281735 TATTTTGACCAAAGGCTTTGGGG - Intergenic
1023880811 7:44320303-44320325 TACTCTGACCTGAGGCTTTTGGG - Intronic
1024689339 7:51782198-51782220 GATGGTGACCAGAGGCTGGGAGG + Intergenic
1026286777 7:68970140-68970162 AAATGTGATCAGAGGCTTGCAGG - Intergenic
1028236433 7:88368203-88368225 TGTTGTGACTAGAGGCTTGCAGG + Intergenic
1028552596 7:92086758-92086780 TGTTGTGACCAAAGGCTTACAGG - Intronic
1028674737 7:93445612-93445634 ATTTGTGACCAGAGGCTTACAGG - Intronic
1028788629 7:94826907-94826929 TGTTGTGACCAGATGCTAGCAGG - Intergenic
1028809167 7:95064181-95064203 AAATGTGACCAGAGGCTGGCAGG - Intronic
1031971934 7:128071304-128071326 TATTGTGACCAGAGGCTCACAGG + Intronic
1032381203 7:131483432-131483454 TGTTGTGACCAGAGGCTTGTAGG - Intronic
1033074812 7:138238884-138238906 TGTTGTGAACAGAGGCTTTCAGG + Intergenic
1033380381 7:140811176-140811198 AAATGTGACTAGAGGCTGGTAGG + Intronic
1033991253 7:147290107-147290129 TATTGTGATCAGAGGCTGGCAGG - Intronic
1034057138 7:148047268-148047290 TACTGTGACCAGAGGCTTGCAGG - Intronic
1034081648 7:148283924-148283946 TGTTATGACCAGATGCTTGCAGG + Intronic
1034106229 7:148492761-148492783 TAATGTGACCAGAAGCTTACAGG - Intergenic
1034827244 7:154276756-154276778 TGTTGTGACCCGAGGCTTGAAGG - Intronic
1035038792 7:155912684-155912706 GAATGTGACCAGAGGCCTGTAGG + Intergenic
1036256096 8:7207942-7207964 TATGGTGACCACAGTCTTGAAGG + Intergenic
1036361390 8:8079557-8079579 TATGGTGACCACAGTCTTGAAGG - Intergenic
1036390682 8:8321902-8321924 TATTGTGACCAGAGGTTCCCAGG - Intronic
1036820250 8:11934318-11934340 CATTCTGACCAGAGGCTTTTTGG + Intergenic
1036833670 8:12040930-12040952 CATTCTGACCAGAGGCTCTTTGG + Intergenic
1036855516 8:12287495-12287517 CATTCTGACCAGAGGCTCTTTGG + Intergenic
1036889585 8:12587466-12587488 TATGGTGACCACAGTCTTGAAGG + Intergenic
1037560667 8:20071903-20071925 TACTGTAACCAGAGGCTTGCAGG + Intergenic
1037828652 8:22175535-22175557 TGTTGTGACCAGAGGCTTGAAGG - Intronic
1038199184 8:25395947-25395969 TGCTTTGACCAGAGGCATGTTGG - Intronic
1039717160 8:40122240-40122262 TGTTGTGAGCAGAGGCTCGTGGG + Intergenic
1039818045 8:41112005-41112027 AAATGTGACCAGAGGCTTGCAGG - Intergenic
1039827433 8:41186851-41186873 TGTTGTGACCAGAGGCTCATAGG - Intergenic
1039886760 8:41659003-41659025 TATTGTGGCCAGAGGCTCATGGG - Intronic
1039898595 8:41734241-41734263 TGTTGTGACCTGAGGCGTGAAGG - Intronic
1040059402 8:43091805-43091827 TTTTGTGCCCACAGGCTTTTTGG - Intergenic
1041654762 8:60337487-60337509 AAATGTGACCAGAGGCTGGCAGG - Intergenic
1041799864 8:61787204-61787226 GATTGTGAGCAGTGGCTGGTTGG + Intergenic
1041914991 8:63129838-63129860 TGTTGTGACCAGGGGCTTGAGGG + Intergenic
1042567570 8:70128113-70128135 TGTTGTGACCAGAGGTCTGCAGG + Intronic
1042577851 8:70240779-70240801 TGATGTGACCAGAGGCCTGCAGG + Intronic
1042855603 8:73263909-73263931 TGTTGGGACCAGAGGCTCATAGG - Intergenic
1042914742 8:73864511-73864533 TAATGTGACCAGAGGCTGGCAGG - Intronic
1043000310 8:74751523-74751545 TGTTGTGACCAGAGGCTTATAGG + Intronic
1043098921 8:76014794-76014816 TGTTGTGACCAGAGGCTTGCAGG - Intergenic
1043818232 8:84829787-84829809 TGTTGTGATCAGAGGCTCATAGG - Intronic
1043871010 8:85432876-85432898 TATTGTTACCCTAGGCTGGTTGG - Intronic
1044876269 8:96669910-96669932 AAATGTGACCAGAGGCTTGCAGG - Intronic
1044913948 8:97091963-97091985 TATTGGTACCAGAGGCATTTAGG - Intronic
1045008757 8:97938790-97938812 TATTGTCACCAGAGGATTGCAGG - Intronic
1045945050 8:107786041-107786063 TATTGTGACTAGAGGCTTGCAGG - Intergenic
1045972678 8:108097240-108097262 TGTTGTGATCAAAGGCTTGTAGG - Intergenic
1046025549 8:108718449-108718471 TGTTGTGAACAGAGGTTTGCAGG - Intronic
1046401783 8:113713870-113713892 TATGGTGACCAGACCCATGTAGG - Intergenic
1046554697 8:115760416-115760438 TAATGTAACCAGAATCTTGTTGG - Intronic
1047259887 8:123246178-123246200 TATTGTGACCAGAGGCTCCCAGG - Intronic
1047545987 8:125817435-125817457 AATTGTGAACAGAGGATTATAGG + Intergenic
1048830359 8:138470779-138470801 TAGTGTGACCAGTGTCTTGAGGG - Intronic
1050204558 9:3182908-3182930 TGTTGTGACCAGAAGCTTGCAGG + Intergenic
1051213630 9:14772982-14773004 TAATGTGACCAGAGACATGACGG - Intronic
1051446747 9:17148363-17148385 TGTTGTGACCAGAGGCTTACAGG - Intronic
1051570246 9:18548594-18548616 TGTTGTGACCAGAGACTTGAAGG + Intronic
1052620630 9:30904679-30904701 TGTTGTGACCAGAGTCTTGTAGG + Intergenic
1053016269 9:34664079-34664101 TCTTGTGTCCCAAGGCTTGTTGG + Intergenic
1054852178 9:69858676-69858698 AAATGTGACCAGAGGCTTGCAGG + Intronic
1055472409 9:76626111-76626133 CATTGTGACCAGATGCTTGCAGG + Intronic
1055852422 9:80648361-80648383 CATTGTAACCAGAGTTTTGTAGG + Intergenic
1056145809 9:83728262-83728284 TGCTGTGACCAGAGACTTGGAGG + Intergenic
1056375702 9:86008563-86008585 TGTTGTGACCAGAGACTCATAGG + Intronic
1056865489 9:90224715-90224737 CATTCTGACCAGAGGCTCTTTGG - Intergenic
1056917515 9:90758171-90758193 CATTCTGACCAGAGGCTCTTTGG + Intergenic
1057015885 9:91651306-91651328 GATGGTTACCAGAGGCTTGGGGG + Intronic
1058374981 9:104312425-104312447 TATTTTGACGAGAGGCTAATTGG + Intergenic
1058998369 9:110322281-110322303 CATTATAATCAGAGGCTTGTTGG + Intronic
1059788107 9:117608912-117608934 TGTTGTGACTAGAGGCTTGCAGG - Intergenic
1062626119 9:137442313-137442335 AAATGTGACCAGAAGCTTGCAGG + Intergenic
1186015074 X:5182138-5182160 GTTTGTGTCCAGAGGCTTGCAGG + Intergenic
1186310723 X:8315454-8315476 TATCGTGACCAGAGGCTGGCGGG + Intergenic
1186940571 X:14502601-14502623 TATTGTGGCTAGAGGCTTATAGG - Intergenic
1187030054 X:15477395-15477417 TATTGTGACCAGAGGCTTGCAGG - Intronic
1189140260 X:38597619-38597641 TGTTGTGACCAGAGGCTTGTAGG + Intronic
1189329671 X:40135769-40135791 TGATGTCACCAGAGGCTTCTGGG - Intronic
1189357289 X:40319976-40319998 TATTGTGACCAGAGGCTTGCAGG + Intergenic
1189365739 X:40387032-40387054 TAATGTGATCAGAGGCTTGTAGG - Intergenic
1189416451 X:40818498-40818520 CATTGTAACCTGAGGCTTCTAGG - Intergenic
1189529096 X:41859837-41859859 TGTTGTGACCAGAGGTTTGAAGG + Intronic
1189559805 X:42180649-42180671 CATTGTGACCAGGGACTTGCAGG + Intergenic
1191593926 X:62922058-62922080 AATAGTTACCAGAGGCTTGTAGG + Intergenic
1192828924 X:74729874-74729896 TATTGTTCCCACAGGATTGTTGG - Intergenic
1193925959 X:87485357-87485379 TATTATGACCAGAGGCTTGCTGG - Intergenic
1194432798 X:93831270-93831292 TGTTGTGACCTGAGGTTTGCAGG - Intergenic
1194768013 X:97865450-97865472 CAATGTGACCAGAAGCTTATAGG - Intergenic
1196930720 X:120679451-120679473 TATTGGGACCAGAAGCGTTTTGG + Intergenic
1199205302 X:145141651-145141673 TATTGTGACCTAAGGATTTTTGG - Intergenic