ID: 964205891

View in Genome Browser
Species Human (GRCh38)
Location 3:154174698-154174720
Sequence TTTTATATTAGAGCACCTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 164}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964205889_964205891 28 Left 964205889 3:154174647-154174669 CCTGTTACAGTTAATTGGGCAAT 0: 1
1: 0
2: 0
3: 11
4: 99
Right 964205891 3:154174698-154174720 TTTTATATTAGAGCACCTAAAGG 0: 1
1: 0
2: 1
3: 10
4: 164
964205890_964205891 -10 Left 964205890 3:154174685-154174707 CCTTTGTCAGATTTTTTATATTA 0: 1
1: 0
2: 2
3: 62
4: 762
Right 964205891 3:154174698-154174720 TTTTATATTAGAGCACCTAAAGG 0: 1
1: 0
2: 1
3: 10
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964205891 Original CRISPR TTTTATATTAGAGCACCTAA AGG Intronic
906657441 1:47559000-47559022 TTTTATATTAGAAAAACAAACGG + Intergenic
906898095 1:49801583-49801605 TTTTATATTTGAGATCCTCAGGG - Intronic
908090541 1:60680972-60680994 TTTAATATTTTAGAACCTAAAGG + Intergenic
908161692 1:61415138-61415160 TTTTATATTAGAGAAGCAAAAGG + Intronic
910502174 1:87905031-87905053 TTTTAGATTAGAAAAACTAAGGG + Intergenic
919291009 1:195630274-195630296 TTTTATCTTAGTCCTCCTAAAGG - Intergenic
920691270 1:208148219-208148241 TGTGATATTAGAGTACCAAAGGG - Intronic
922085455 1:222342597-222342619 TTTTATCTATGAGCACCGAAGGG + Intergenic
1063778863 10:9297576-9297598 TTTTATTTTTTAGCACCTATTGG - Intergenic
1063826533 10:9904715-9904737 TTTTATAGTAGAACTCTTAAAGG + Intergenic
1066591914 10:37004723-37004745 TTTTATATTAGAGAAAATTATGG + Intergenic
1067919188 10:50435987-50436009 TTTTCTATTATAGCAAATAAAGG - Intronic
1068044307 10:51866638-51866660 TTTTAAATTAGTGTACCTCATGG - Intronic
1070570360 10:77636554-77636576 TGTTCCACTAGAGCACCTAAGGG + Intronic
1071928110 10:90434734-90434756 TTATATAGTAAAGAACCTAAAGG - Intergenic
1072000641 10:91192744-91192766 TTTTAAAATAGAGCACAGAAAGG + Intronic
1073260667 10:102188090-102188112 TTTAGTATTAGAGCAGCTCAGGG + Intergenic
1077630138 11:3806099-3806121 ATCTAAATTAGAGCACCTCAAGG + Intronic
1077948483 11:6928208-6928230 GTTTCTATTCAAGCACCTAAGGG - Intronic
1078965924 11:16342151-16342173 TTTTATATGAGAGCACAGAATGG - Intronic
1079048896 11:17135453-17135475 TGTTGTTTTAGAGCAACTAATGG - Intronic
1080141825 11:28930970-28930992 TTCTATTTTAGTGCACCTGAAGG + Intergenic
1081316389 11:41636344-41636366 TTTTTTATTAGTGTAGCTAATGG + Intergenic
1081977280 11:47243709-47243731 TTCCTTATTTGAGCACCTAAGGG - Intronic
1085896324 11:80643826-80643848 TTTTATATTAGAGAAAATTATGG - Intergenic
1086799120 11:91149606-91149628 TTCTATATTTGAGCGCCTAATGG + Intergenic
1087156122 11:94906277-94906299 TTTTATATTAGTCAACCTAGTGG - Intergenic
1090929166 11:131279709-131279731 TTTTATTTTAGAGGCCCTAGGGG + Intergenic
1092199805 12:6573484-6573506 TTTTGTATAAGAGAACCTAAAGG - Intronic
1092647933 12:10599603-10599625 TTTCATGTTATAGCCCCTAAGGG - Intergenic
1093093500 12:14946872-14946894 TTTATTATTGGAGCACCTGAAGG - Intronic
1095362248 12:41356790-41356812 TTTTATCTTTGAACAACTAAAGG + Intronic
1095545833 12:43368444-43368466 TTTTCTGTTAGAGAACTTAAAGG - Intronic
1095746493 12:45665022-45665044 TTTTAGATTGGGGTACCTAAAGG - Intergenic
1096442303 12:51653877-51653899 TTTAATATTAGACATCCTAATGG + Intronic
1099024069 12:77443540-77443562 GTTTATCTTAGAAAACCTAATGG + Intergenic
1100734330 12:97510466-97510488 TATTAAATAAGAGCACGTAATGG - Intergenic
1101000665 12:100354488-100354510 TTATCTCTTAGAGCACATAACGG - Intergenic
1102625462 12:114232226-114232248 TTGAATAGCAGAGCACCTAAAGG + Intergenic
1104155108 12:126123708-126123730 ATTAATATTAGAACAACTAATGG - Intergenic
1105582900 13:21717808-21717830 TACTATATTATAGCACCTGAGGG + Intergenic
1106833646 13:33611517-33611539 GTTGCTATTAGAGCAACTAAGGG - Intergenic
1109959343 13:69610743-69610765 TTTCATATTATAGCTCCTATGGG - Intergenic
1111093461 13:83477764-83477786 TTTTTTACTAGAGAAGCTAAGGG + Intergenic
1111708807 13:91785143-91785165 TTTAATATTGGTGCACCTGAGGG + Intronic
1113121200 13:106925180-106925202 TTTTAGAGAATAGCACCTAATGG + Intergenic
1115082229 14:29468871-29468893 TTTGATATTAGTCAACCTAATGG + Intergenic
1115926845 14:38445548-38445570 TTTTTTATTAGTCTACCTAATGG + Intergenic
1116145204 14:41058251-41058273 TTTTATAATAGACATCCTAATGG + Intergenic
1118322899 14:64763782-64763804 TTTTACATTAGAGCACGTTCTGG - Intronic
1118388250 14:65274669-65274691 TTTTAACTTAAAGCACATAAAGG + Intergenic
1120869770 14:89326658-89326680 TTTTATATTAGTGTACATAATGG + Intronic
1124199229 15:27662965-27662987 TCCTATCTTAGTGCACCTAAAGG + Intergenic
1125209375 15:37195161-37195183 ATTTCTATTAGAACATCTAATGG + Intergenic
1126223817 15:46246037-46246059 TCTTATATGAGAGGACCTCATGG + Intergenic
1128696380 15:69766580-69766602 TTTTATAATAGCACTCCTAATGG + Intergenic
1138083467 16:54113737-54113759 TTTTAAATATGGGCACCTAATGG - Exonic
1138636575 16:58343884-58343906 TTCTATAATAGACCTCCTAATGG + Intronic
1139083431 16:63554664-63554686 TTTTATATAACAGCATTTAATGG - Intergenic
1145227841 17:21145353-21145375 TTTTAAATTATAGTACTTAATGG + Intronic
1146898587 17:36564986-36565008 TGTTATGTAAGATCACCTAAAGG + Intronic
1148908106 17:50924134-50924156 TTTTATAGCAGATCTCCTAAAGG + Intergenic
1150932719 17:69602739-69602761 TTTTATAGGAGAGCATGTAAAGG + Intergenic
1151427341 17:74039587-74039609 TTTTATATTTAACCACCTCAGGG - Intergenic
1155646334 18:28082634-28082656 TTTTATATTAGATCATAAAATGG + Intronic
1156712877 18:39967704-39967726 TTTCATATTAGATCAAATAAAGG + Intergenic
1157959525 18:52136963-52136985 TTCTATGTTAGTGCACCCAATGG + Intergenic
1159641536 18:70868293-70868315 TTTCATATTAGAGATCCTGAGGG - Intergenic
1167407545 19:49323675-49323697 TTTTATATTAGCCATCCTAATGG - Intronic
927346278 2:22046286-22046308 TTTTGTATTAAAGCAAGTAAAGG + Intergenic
927656870 2:24955843-24955865 TCATATATGAGAGCATCTAAGGG - Intronic
929673609 2:43901597-43901619 TTTTAAATATGAGCACCAAATGG + Intronic
931499707 2:62852113-62852135 TGTTATATTTGAGCACCGCAGGG - Intronic
932197814 2:69799289-69799311 CTCTATCTTAGTGCACCTAAAGG + Intronic
932210433 2:69924023-69924045 TTATTTATTATAGCACCTCAGGG + Intronic
936736251 2:115446709-115446731 TCCTATCTTAGTGCACCTAAAGG + Intronic
939264631 2:139855353-139855375 TTTTCTATTAGATCCCCGAAAGG + Intergenic
939819688 2:146942400-146942422 TTTTATCTTACAGCACCTCATGG + Intergenic
942284198 2:174397347-174397369 ACTTATAATAGAACACCTAAAGG - Intronic
942935190 2:181547486-181547508 TTGTATATTAGAGATTCTAAGGG - Intronic
943234969 2:185306098-185306120 TTTGATATGAGAGCAACAAATGG + Intergenic
943396477 2:187341793-187341815 TTTTATTTTAGACATCCTAATGG - Intergenic
943639790 2:190345032-190345054 TTTTAAAATAGAGAACATAAGGG + Intronic
944948443 2:204718048-204718070 TTTTATTTTAGAGAACCCGAGGG + Intronic
945399811 2:209367463-209367485 TTTTATATTGAAGCACACAAAGG - Intergenic
946381483 2:219351865-219351887 TTTTCTATTTGAGCTCCAAAGGG + Intergenic
1173329699 20:42064521-42064543 TTATATATTAGAAAACATAATGG - Intergenic
1174765352 20:53248578-53248600 GTTTATAGTAGACCAGCTAATGG + Intronic
1176864827 21:14041559-14041581 TCTTATATGAGAGGACCTCATGG + Intergenic
1177416094 21:20795042-20795064 TGTTATATTATAGAACATAACGG - Intergenic
1177440237 21:21113392-21113414 TTTTATATCTAAGCACTTAACGG + Intronic
1177717923 21:24864606-24864628 TTTTACATTAGAAACCCTAATGG - Intergenic
1182889473 22:33805098-33805120 TTTTTTATTTGAGCACCTAAAGG - Intronic
1183388275 22:37527690-37527712 TTTTATTTAACAGCACCTACCGG + Intergenic
949319698 3:2795493-2795515 TCTTATATTAGAGTAACAAATGG + Intronic
950344941 3:12285306-12285328 TTTTATTTTAGCCAACCTAAAGG - Intergenic
953197894 3:40751161-40751183 TGTTAAAATAGAGCACTTAATGG + Intergenic
953250637 3:41243553-41243575 TTATTTATTAAAACACCTAATGG + Intronic
955031095 3:55219590-55219612 TTTTATCTTAGCCTACCTAAAGG + Intergenic
955727273 3:61946825-61946847 TCTTATGTTAGAGCTCCTTACGG + Intronic
957861028 3:85949826-85949848 TTTTATATTAAAGGAAGTAATGG + Intronic
959295951 3:104534216-104534238 TTTTTTATTAGTGTAGCTAATGG - Intergenic
960902680 3:122567566-122567588 TCTTATATTTGAGCTTCTAAAGG + Intronic
961123728 3:124397015-124397037 CTTGTTACTAGAGCACCTAAGGG + Intronic
962993243 3:140599145-140599167 TGAGATATTAGAGCACATAAAGG + Intergenic
964205891 3:154174698-154174720 TTTTATATTAGAGCACCTAAAGG + Intronic
965696021 3:171409010-171409032 TTTTATATTAGTGTCCCTGAAGG - Intronic
968227779 3:196986052-196986074 TTTTATAATAGTCAACCTAATGG - Intergenic
970069002 4:12134305-12134327 TTTTATATAAGAAACCCTAAAGG + Intergenic
970185838 4:13452174-13452196 TTTTATCTTAGTGTATCTAATGG + Intronic
976766691 4:88605330-88605352 TCTAATATTAGGGTACCTAAAGG + Intronic
976863516 4:89695228-89695250 TTTGATTTTACAGCAACTAAAGG - Intergenic
977690201 4:99897867-99897889 TTTTATATCAGAGGACCAAATGG - Exonic
977755115 4:100660737-100660759 TTTTATATTATATTACCAAATGG + Intronic
979109019 4:116726594-116726616 GTTTACATTAGAGAACCTGAGGG - Intergenic
979906727 4:126302560-126302582 TTTTATATAAGAGCCACTAGAGG - Intergenic
980810603 4:137873909-137873931 TTTTTTATTAGGCCATCTAAAGG + Intergenic
980981334 4:139656904-139656926 TTTTACATTTGAGCACCTGTGGG + Intergenic
981422197 4:144563930-144563952 TTTTATATCTAAGCACCTACAGG + Intergenic
982566451 4:156993034-156993056 TTTGATATTACTGAACCTAAAGG - Intergenic
987267697 5:16275177-16275199 TTTTCTATTTGAGCACTCAATGG - Intergenic
989281343 5:39647197-39647219 GTTCATATTAGACAACCTAAAGG + Intergenic
989530472 5:42502049-42502071 TTTTATATGTGAGCACCAATGGG - Intronic
993289416 5:86045835-86045857 TTTTATATTATAGTACTTTAAGG - Intergenic
993491362 5:88555186-88555208 TTTTATATAAAAGTACGTAATGG + Intergenic
995031605 5:107488025-107488047 ATTGATATTAGAGACCCTAAAGG - Intronic
995684558 5:114758021-114758043 TTTTATATTAGATCATCAAAAGG + Intergenic
996170073 5:120279590-120279612 TTTTATATTAAAGTAAATAAGGG - Intergenic
997542520 5:134675524-134675546 TTTTAAATGAGAGCAAATAAAGG - Intronic
998102014 5:139442349-139442371 TTTTATATTCAACCACCTGATGG - Intronic
1003925445 6:10873622-10873644 TTTCCCATTAGAGCACCTTAGGG - Exonic
1008202377 6:48606767-48606789 TTTTGTTTAAGAGCACTTAAAGG + Intergenic
1008310229 6:49959547-49959569 TTTAATATTAGAGAAACTACTGG + Intergenic
1009909369 6:69906160-69906182 TTTTCTATTGAAGCAACTAATGG - Intronic
1010555223 6:77271051-77271073 AATTATATGAGAGCACATAATGG - Intergenic
1012459216 6:99442279-99442301 TGTCATATCAGAGCGCCTAATGG - Intronic
1012478013 6:99636243-99636265 TTTTAGATTAGAGGACATTAAGG + Intergenic
1012479573 6:99651270-99651292 TTCTATATCAGAGCAACAAAGGG - Intergenic
1015304618 6:131694005-131694027 TTTTATAAAAGAGCACATATAGG + Intronic
1015757694 6:136624420-136624442 TTTTAAAATAGAGAATCTAATGG + Intronic
1016154698 6:140790612-140790634 TTTTATATTCAAGCAACTACTGG + Intergenic
1016246920 6:141993922-141993944 ATTCATATTAGAACTCCTAAAGG - Intergenic
1017119036 6:151006479-151006501 TTTTATATTAAGGCACTTTAGGG + Intronic
1017251875 6:152289303-152289325 TTTTATGTTAGAGAAGCTCATGG - Intronic
1026646571 7:72175933-72175955 TTTTATTTTAGTGCACTTAAAGG - Intronic
1027981344 7:85226979-85227001 TTTTATTTGAAAGCACATAAAGG - Intergenic
1028522875 7:91751821-91751843 TTATATAATAGAAAACCTAAAGG + Intronic
1028820095 7:95199149-95199171 TATTATATTACAGCACACAAGGG - Intronic
1038687311 8:29730279-29730301 TTTTATATTATAGGACATATAGG + Intergenic
1038879800 8:31596244-31596266 TGTTATCTTAGAGCACCTCCTGG - Intergenic
1040453934 8:47576792-47576814 ATTTATATTAGAGCATTTTAAGG - Intronic
1041434811 8:57827153-57827175 CTTTATCTAAGAGCCCCTAATGG + Intergenic
1045960768 8:107965387-107965409 TGTTATATTAGAGCCCGTACGGG - Intronic
1046234049 8:111398147-111398169 CCTTATCTTAGTGCACCTAAAGG + Intergenic
1046741273 8:117831676-117831698 TTTCCTATTAAAGCAGCTAACGG - Intronic
1046749510 8:117912322-117912344 TTTTCTATTTTAGGACCTAAGGG + Intronic
1052240110 9:26261645-26261667 TCCTATCTTAGTGCACCTAAAGG + Intergenic
1055198402 9:73625679-73625701 TTTTATATTGGCGCAGCTACCGG + Intergenic
1055466067 9:76567915-76567937 ATTTCTATTAGATAACCTAATGG + Intergenic
1056376089 9:86012595-86012617 TTTTAGATGAGAACACCTTATGG + Intronic
1058950851 9:109902679-109902701 TTTTAGAGTAGAGGACCTCATGG + Intronic
1059109953 9:111547321-111547343 TTTTATAATAGACATCCTAATGG + Intronic
1185775093 X:2796728-2796750 TTTTATTTTAGAAGACATAAAGG + Intronic
1187122842 X:16425806-16425828 TTTTCTATTAAAGCAATTAATGG - Intergenic
1188181579 X:27062883-27062905 TTTTATAATAGACATCCTAACGG - Intergenic
1188739642 X:33762760-33762782 TTGTATATTTGATCACTTAATGG + Intergenic
1189020514 X:37332971-37332993 TTTTATAACATAGCACCAAAAGG - Intergenic
1190147650 X:47910685-47910707 TATTATAATACAGCACCTAGTGG - Intronic
1192090935 X:68155164-68155186 TTGTGTATTAGAGAACATAAAGG + Intronic
1192597338 X:72425225-72425247 TTTAATAATAGACAACCTAATGG + Intronic
1192698694 X:73445913-73445935 TTTAAAAATAGAGAACCTAATGG - Intergenic
1192852747 X:74975133-74975155 TTTTATTTTAAAGCATCTACAGG + Intergenic
1193392820 X:80949126-80949148 TATTATATTATAGCTCCTGAGGG - Intergenic
1194731303 X:97458622-97458644 TTTTATATTGGAGCACATGATGG + Intronic
1199739166 X:150716769-150716791 TGTTTTATTAAAGGACCTAAAGG - Intronic
1199754470 X:150851498-150851520 TTTACTTTTAGAGCACCTTAGGG - Intronic