ID: 964211477

View in Genome Browser
Species Human (GRCh38)
Location 3:154233129-154233151
Sequence CTGGTAAGAAACCCAATTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 148}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964211477_964211478 -7 Left 964211477 3:154233129-154233151 CCTAGAATTGGGTTTCTTACCAG 0: 1
1: 0
2: 1
3: 9
4: 148
Right 964211478 3:154233145-154233167 TTACCAGACATTCCAAATCATGG 0: 1
1: 0
2: 0
3: 10
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964211477 Original CRISPR CTGGTAAGAAACCCAATTCT AGG (reversed) Intronic
900885115 1:5409720-5409742 CTGGTAAGAAACCCCTTTGCAGG - Intergenic
901498057 1:9633670-9633692 CTGCTAAGAAACCCAAACCTCGG - Intergenic
902251829 1:15158661-15158683 CAGGTAGGACACCCCATTCTGGG + Intronic
904268860 1:29335338-29335360 CTGGGAAGAGACCCCATTTTGGG + Intergenic
906973452 1:50543998-50544020 CTGGGAAGAAATCCATTCCTGGG + Intronic
908979757 1:69941503-69941525 GTGGTAAGAAACCAATTTCTGGG + Intronic
911163640 1:94706337-94706359 CTGGGAAGAAAAACATTTCTTGG + Intergenic
911905827 1:103567635-103567657 CTGGGAAGAAACCAGATTATAGG - Intronic
916935002 1:169618533-169618555 CAGGAAAGAAACCCATTTCCAGG - Intronic
918433178 1:184483595-184483617 GTGGTAAGAAAAGCAATGCTAGG - Intronic
920102487 1:203526043-203526065 ATGGGAAGAAACAGAATTCTTGG + Intergenic
923368596 1:233287738-233287760 CAGGTAAGAACTCCAATGCTTGG + Intronic
923601547 1:235407594-235407616 CTTGTAATAAACTGAATTCTTGG + Intronic
1063939642 10:11114039-11114061 CTCATAACAAATCCAATTCTGGG + Intronic
1065297050 10:24286718-24286740 ATGGTAAAAATCCTAATTCTGGG + Intronic
1066270084 10:33813763-33813785 CTGGTAACCAACCCAGTTCCTGG + Intergenic
1066791768 10:39072908-39072930 CAGGTAAGAAACACTATTTTTGG + Intergenic
1066796561 10:39128288-39128310 CTGGTAGTAAACACTATTCTTGG + Intergenic
1070733952 10:78850936-78850958 CTGCTAACAAACCCAGTACTAGG - Intergenic
1072054937 10:91745531-91745553 CTGAGCAGAAACCCAACTCTAGG + Intergenic
1072921474 10:99580647-99580669 CTGGTCAGAAATGCAAATCTCGG + Intergenic
1074077813 10:110145247-110145269 CCAGTAAGAAACCCCATTGTTGG + Intergenic
1078821733 11:14890367-14890389 ATGGGAATAAACTCAATTCTGGG + Intronic
1079169137 11:18075462-18075484 CTGGCAAGGATCACAATTCTGGG - Intronic
1083493920 11:63033935-63033957 CAGGTAAGAAGCCCTCTTCTAGG - Intergenic
1084893802 11:72250821-72250843 CTGGGAAGGATCCCAGTTCTGGG - Intergenic
1089586569 11:119513293-119513315 CTGGCAAGAACCCCATCTCTGGG - Intergenic
1089787609 11:120919477-120919499 CTTGTCAGAATCCCAATTCTGGG + Intronic
1090318172 11:125816504-125816526 CTGGTAATAAAGAGAATTCTGGG - Intergenic
1092279079 12:7086166-7086188 GTGGTATGAAATTCAATTCTGGG + Intronic
1092314488 12:7396075-7396097 CTGGTAAGATACCCAAACCAGGG - Exonic
1094824494 12:34258917-34258939 CTGGTAAGAAGACAAATGCTGGG + Intergenic
1098448897 12:70596856-70596878 TTGGTAAGCAACCCTATCCTAGG - Intronic
1099368883 12:81805382-81805404 CTGGTAAGAAATTGAGTTCTTGG + Intergenic
1101451564 12:104784548-104784570 TTGGTAAGAAACTCAATTCCGGG + Intergenic
1101513298 12:105411779-105411801 AAGGGAAGAAACCCAATTATTGG + Intergenic
1103961683 12:124612808-124612830 CAGGTAAGAAAACCAAGACTCGG + Intergenic
1105302168 13:19145484-19145506 CTGGTAAGAAACCCAAAAAGGGG - Intergenic
1108145423 13:47471682-47471704 CTACTCAGAAACCCCATTCTAGG + Intergenic
1109032084 13:57204652-57204674 CTGAAAAGAGACCCAATTCCAGG + Intergenic
1109214349 13:59570878-59570900 ATGGTAAGAAAGTCAATTTTTGG + Intergenic
1109934192 13:69259663-69259685 CTGGTAACAATCCCACTTCTAGG + Intergenic
1113490815 13:110690332-110690354 CTGGGAGGAAAGCCAAGTCTGGG - Intronic
1113547119 13:111161907-111161929 CTGGTAATAATCCCCATTTTTGG + Intronic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1114385891 14:22254061-22254083 CTGGAAAGAAACCCAGTTCTGGG - Intergenic
1116977381 14:51131332-51131354 TTGCCAATAAACCCAATTCTGGG - Intergenic
1117225446 14:53653789-53653811 AAGGTGAGAAACCCAATTCAGGG + Intergenic
1120254100 14:82096382-82096404 AGGCTAAGAAACCAAATTCTAGG + Intergenic
1120802243 14:88703647-88703669 CAGGTAAGAAAACGAATGCTGGG + Intronic
1122757624 14:103995205-103995227 CTGGTTAGAAGCCATATTCTAGG + Intronic
1125839418 15:42784907-42784929 CTTGTAAGAAATTAAATTCTTGG + Intronic
1126967531 15:54072357-54072379 TTGGTAATAAACCCAAATCCAGG + Intronic
1129604077 15:77016317-77016339 CTGGGAAGAAAAACAAATCTGGG - Intronic
1131625912 15:94120440-94120462 CTTGTCAGAAACCCATGTCTTGG + Intergenic
1131881722 15:96869176-96869198 CTTGTAGGAAACCCAAATCAAGG - Intergenic
1132376473 15:101331538-101331560 CTGGTAAGTTAGCCACTTCTAGG - Intronic
1133587797 16:7212499-7212521 CTGTTGAGAAACCCCACTCTAGG - Intronic
1133727510 16:8551152-8551174 CTGGTAAAAACCAGAATTCTAGG - Intergenic
1134897534 16:17902364-17902386 TTAGGAAGAAGCCCAATTCTTGG - Intergenic
1135276986 16:21121734-21121756 CTTGTTAGAAGCACAATTCTGGG + Intronic
1136017301 16:27408898-27408920 CTGGAAAGAACCCAAGTTCTTGG - Intronic
1136218722 16:28813443-28813465 CAGGTAAAAAGCCCAATTATCGG + Intergenic
1136641759 16:31570646-31570668 CTGGCAGGATACACAATTCTTGG - Intergenic
1137484849 16:48882358-48882380 CTGGGAAGAAGCCCAAGCCTTGG - Intergenic
1137947642 16:52750345-52750367 CTGGTGAGAAAATAAATTCTTGG - Intergenic
1138845953 16:60566467-60566489 AAGATGAGAAACCCAATTCTTGG - Intergenic
1140756757 16:78074549-78074571 CTTGTTAGAAATGCAATTCTGGG - Intergenic
1140826324 16:78710029-78710051 CTGGTAAGAAAGGCAACTATCGG - Intronic
1142256470 16:89015977-89015999 CTGAGCAGAAACCCCATTCTTGG + Intergenic
1142277440 16:89128788-89128810 CTGAAAAGAAACCACATTCTGGG - Intronic
1144376827 17:14651125-14651147 CTGGGAAGAAAACCAAGTTTGGG - Intergenic
1144992075 17:19239930-19239952 CTTATCAGAATCCCAATTCTTGG - Intronic
1145957200 17:28862672-28862694 CTGTTTAGAATCCCCATTCTGGG + Intergenic
1146711102 17:35042108-35042130 GTGGTAAGAAACCCAAGCTTTGG - Intronic
1146790710 17:35749059-35749081 TGGGCAAGAAACCCTATTCTGGG + Intronic
1148791208 17:50174016-50174038 CCTCTAAGAAAACCAATTCTTGG + Intronic
1153311341 18:3679979-3680001 CTAGTAAGAAACCCATGGCTGGG - Intronic
1155469625 18:26177418-26177440 CTGTTACTAACCCCAATTCTTGG - Intronic
1164023058 19:21326202-21326224 CTGGGTAGATACCCAATTGTGGG - Intronic
1164777479 19:30864201-30864223 CTGCTGAGAAATTCAATTCTGGG - Intergenic
1166132194 19:40752440-40752462 CTGCTTAGGAACCCAATTTTTGG + Intronic
925067912 2:943435-943457 CTGGCAACAATCCCAAGTCTAGG - Intergenic
929816697 2:45238192-45238214 CTGGTACTAAACCACATTCTGGG - Intergenic
932576382 2:72964547-72964569 CTGGTAGGAAAACAAAATCTAGG - Intronic
935044663 2:99469815-99469837 CTGGTGATAAACATAATTCTCGG - Intronic
937560334 2:123216011-123216033 TTGAGAAGAAACCAAATTCTAGG - Intergenic
939818376 2:146924246-146924268 CTGGTAAGAGACTGAATTCCTGG - Intergenic
939974564 2:148702575-148702597 CTGGTTAAAAATCCACTTCTGGG - Intronic
940935824 2:159493988-159494010 CTGGTAAGAAACTAAAGCCTAGG + Intronic
942093791 2:172519063-172519085 CTGGTTAGAACCCCACTCCTGGG + Intergenic
942957976 2:181796527-181796549 CTGCTAACAATCTCAATTCTAGG - Intergenic
1169905455 20:10598750-10598772 CTGGTAAGAAGCCGATTTCTTGG + Exonic
1170283860 20:14683378-14683400 CTTGTAAGAAAACCAGTGCTTGG + Intronic
1173281461 20:41631940-41631962 TTGGTAAAAATCCAAATTCTTGG + Intergenic
1177212239 21:18085619-18085641 TTGGCAAGATACGCAATTCTTGG + Intronic
1182178667 22:28321096-28321118 CTGGTAAAAAATCCATTTTTAGG + Intronic
1182838787 22:33367039-33367061 TTGGTAAGTAACACATTTCTAGG + Intronic
949524427 3:4889179-4889201 CTGGTAAGAAATGCACTTGTGGG - Intergenic
952541173 3:34369830-34369852 CTGATAAAATACCCAAGTCTGGG - Intergenic
954015535 3:47686683-47686705 CTATTAAGAAACCAAATTATGGG + Intronic
954817744 3:53296294-53296316 CTGGTAAGATAACCAAGGCTAGG + Intronic
955261051 3:57390892-57390914 CTGGTATAAAACCAAATTCCTGG + Intronic
955589135 3:60515201-60515223 CTGGGAAGAAAACCAACTGTAGG + Intronic
958487254 3:94728398-94728420 CTAGTCAGTCACCCAATTCTTGG - Intergenic
959392331 3:105791794-105791816 CTGATCAGAAACCAAATGCTAGG - Intronic
960803990 3:121565095-121565117 CTGGTAACAAGCACTATTCTGGG - Intergenic
961674339 3:128555623-128555645 ATGGCAAGAAACCCAGTCCTCGG - Intergenic
964211477 3:154233129-154233151 CTGGTAAGAAACCCAATTCTAGG - Intronic
964569654 3:158097766-158097788 CTCCTACAAAACCCAATTCTAGG + Exonic
964646000 3:158959172-158959194 CTGCTAAGAGAACCAATTATTGG + Intergenic
971212683 4:24634853-24634875 CTTTTAAAAAATCCAATTCTAGG - Intergenic
971942502 4:33234125-33234147 CTGGTTAGTAACCTAATTCTGGG - Intergenic
972308929 4:37861219-37861241 TTTGTAAGAAACACAATTTTTGG - Intronic
975743125 4:77449929-77449951 CTGTTAAGAAACCAAGATCTGGG + Intergenic
976026846 4:80698318-80698340 GTGGTACAAAACACAATTCTTGG - Intronic
978329173 4:107593548-107593570 CTGGTAAGAAATTCATTCCTTGG - Intronic
980380602 4:132010422-132010444 CTGGTAAGGACCCCAGTTATTGG - Intergenic
985910718 5:2878578-2878600 TTGGCAAGGAACCCAATTCAAGG - Intergenic
988660832 5:33266415-33266437 CTGGTAAGAGACAGAATTGTAGG + Intergenic
989433369 5:41381677-41381699 CTTTTAAGAAACCCAATTAGTGG + Intronic
995593000 5:113719157-113719179 CTGGTAAGTATTCAAATTCTGGG - Intergenic
996511784 5:124324692-124324714 CTGTTAAGACACCCAGTTCGTGG - Intergenic
998806581 5:145922795-145922817 CTGGTAACAAAACCAAAGCTAGG + Intergenic
1000670031 5:164049934-164049956 CTTGTAAAAAACACAATTCTTGG - Intergenic
1002204903 5:177555704-177555726 CTGGTAAGAACCCCAACTGCAGG + Intergenic
1005172808 6:23007844-23007866 CTCTTAAGCAACCCCATTCTTGG + Intergenic
1007318053 6:41005547-41005569 CTATTAAAAAACCAAATTCTGGG - Intergenic
1008145089 6:47881526-47881548 CTTCTAAGAAAACCAAATCTTGG + Intronic
1009501835 6:64423551-64423573 ATGTTAAGAAACCAAATTCTTGG + Intronic
1010232376 6:73546307-73546329 CTGTTAAAATACCAAATTCTTGG + Intergenic
1016675140 6:146756382-146756404 CGGGTAAGAATCCCATTTCCAGG + Intronic
1021208745 7:17817425-17817447 CTGTAAAGAAAACTAATTCTTGG + Intronic
1021828838 7:24582778-24582800 TTTATAAGAAACCCAATTATTGG - Intronic
1022756410 7:33296689-33296711 TTGGAAAGAAACACAAGTCTGGG - Intronic
1023335206 7:39161859-39161881 ATGAGAAGACACCCAATTCTTGG - Intronic
1027739417 7:81981422-81981444 CTGTTAACAAAGCCTATTCTTGG - Intronic
1033350735 7:140559719-140559741 CTGGACAGGAACCCAATCCTTGG + Exonic
1033483833 7:141768368-141768390 CTGATAAGAAAGATAATTCTAGG - Intronic
1036865166 8:12390141-12390163 GTGGCAAGAAAGCCCATTCTGGG + Intergenic
1037360180 8:18064969-18064991 CTGCCAAGAAACTCCATTCTAGG + Intronic
1038162378 8:25052253-25052275 CTGAAAAGAAACTCATTTCTGGG - Intergenic
1046062889 8:109159992-109160014 CTTGTTAGAAATGCAATTCTTGG - Intergenic
1046239598 8:111474005-111474027 ATAGTAAAAAACCCACTTCTGGG + Intergenic
1047901531 8:129427697-129427719 CTGGTATGAAACCCACTTGGTGG + Intergenic
1050758961 9:9042468-9042490 CTGGTGACAACCCCAATTTTCGG - Intronic
1050822346 9:9895229-9895251 CTGGTAACAAACAGAATTCCTGG - Intronic
1051228585 9:14929420-14929442 CTAGAAAGAATACCAATTCTGGG + Intergenic
1055574895 9:77650883-77650905 CTGGTAAGAAACAGAAAACTGGG + Intergenic
1060463729 9:123883512-123883534 CTTGTTAGAAATACAATTCTTGG - Intronic
1060580951 9:124746112-124746134 CTTATTAGAAACACAATTCTGGG + Intronic
1061203462 9:129150182-129150204 CAGCCAAGAACCCCAATTCTTGG + Intergenic
1187782887 X:22848463-22848485 CTGGTAAAAAAACAAAATCTGGG + Intergenic
1187878539 X:23824772-23824794 CTGCTCAAAAGCCCAATTCTGGG + Intergenic
1188389470 X:29601910-29601932 TTGAAAAGAAACCAAATTCTAGG - Intronic
1193121961 X:77832528-77832550 CTGATAAGAAAATCAATTTTCGG + Intronic
1195804269 X:108745238-108745260 AGGGTAAGAAATACAATTCTAGG - Intergenic
1196576871 X:117328600-117328622 CTGGTCAGATGCCCAGTTCTGGG + Intergenic
1197160206 X:123314237-123314259 CATGTAAGAAACCCTATTCATGG + Intronic