ID: 964223033

View in Genome Browser
Species Human (GRCh38)
Location 3:154368157-154368179
Sequence CGCCAGAGGCTCCCCCTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 3, 1: 7, 2: 2, 3: 20, 4: 208}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964223025_964223033 5 Left 964223025 3:154368129-154368151 CCAGATTTCCTGGTTGAGACCAT 0: 3
1: 6
2: 8
3: 8
4: 135
Right 964223033 3:154368157-154368179 CGCCAGAGGCTCCCCCTGCAAGG 0: 3
1: 7
2: 2
3: 20
4: 208
964223027_964223033 -3 Left 964223027 3:154368137-154368159 CCTGGTTGAGACCATGGCCCCGC 0: 1
1: 5
2: 10
3: 8
4: 116
Right 964223033 3:154368157-154368179 CGCCAGAGGCTCCCCCTGCAAGG 0: 3
1: 7
2: 2
3: 20
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964223033 Original CRISPR CGCCAGAGGCTCCCCCTGCA AGG Intronic
900099967 1:957925-957947 CCCCAAATGCTCCCACTGCAAGG + Intronic
900254654 1:1691764-1691786 CGCCAAAGGCACCCCGTGGAGGG + Intronic
900263406 1:1745039-1745061 CGCCAAAGGCACCCCGTGGAGGG + Intronic
900606295 1:3525124-3525146 ACCCACAGGCTCCCCGTGCAAGG + Intronic
900740079 1:4325760-4325782 AGCCTCAGGCTGCCCCTGCAGGG + Intergenic
900881144 1:5382227-5382249 CCCCAGAAGCTTCCCCTGCCAGG - Intergenic
901220954 1:7583523-7583545 AGGCAGAGGCTGGCCCTGCATGG + Intronic
901601910 1:10429231-10429253 CGTCAGAGGCTTGCCCTGCTTGG + Intergenic
901974247 1:12931908-12931930 CCCCAGAGTCTCCCCCTCCAGGG + Intronic
902010928 1:13269860-13269882 CCCCAGAGTCTCCCCCTCCAGGG - Intergenic
902516499 1:16992388-16992410 CACCGGGGGCTCCTCCTGCAGGG + Exonic
902519809 1:17009889-17009911 CTCCAGAGCCCCTCCCTGCAGGG + Intronic
902867392 1:19288463-19288485 CCCCTGATCCTCCCCCTGCACGG - Intronic
903211922 1:21823474-21823496 CGTCAGGGGCTCCGCCTGCCGGG + Exonic
905890955 1:41518121-41518143 TGCCAGGCGCTCCACCTGCATGG + Intronic
912143346 1:106758986-106759008 CTCCCGAGACTCCTCCTGCAAGG + Intergenic
913257531 1:116967255-116967277 CGCCAAAGGCTGCCCCTGACAGG - Exonic
914437183 1:147670429-147670451 CGGCAGCGGCTCCACCAGCAAGG + Exonic
914665992 1:149832961-149832983 CGCCAGGGGCGCACCCTGTACGG + Intergenic
914669773 1:149860833-149860855 CGCCAGGGGCGCACCCTGTACGG - Exonic
919514873 1:198510783-198510805 GGCCTGAGTCTCCCCCTTCAGGG + Intergenic
920850143 1:209623080-209623102 AGCCTGTGGCTCCCGCTGCAGGG - Exonic
922724062 1:227914445-227914467 AGCCAGAGGCCTCCCCAGCAGGG - Intergenic
922729199 1:227941212-227941234 AGCCTGAGGCTCTCCCTGCCAGG - Intronic
922748287 1:228059470-228059492 CGGCCGCGGCTCCCCCTGGACGG + Exonic
922800586 1:228363008-228363030 AGCCAGAGGCTTCCCATGCTTGG + Intronic
923224938 1:231930556-231930578 CTCCAGAGGCTCCCACTGCCTGG - Intronic
923306257 1:232691625-232691647 TGCCAGAAGCTCCGCCTGGATGG + Intergenic
924643641 1:245857251-245857273 CGGCAGAGGCTCCACCAGCCAGG - Intronic
1068143048 10:53029564-53029586 CGCCAGAGGCTCCCACTGCATGG - Intergenic
1071559280 10:86632556-86632578 CCCCTGAGGCTGGCCCTGCAGGG - Intergenic
1074531343 10:114300812-114300834 AGCCAGTGGCCCCCCCAGCAGGG - Intronic
1076484167 10:130805127-130805149 CTCCCCAGGCTCCCCCTCCACGG + Intergenic
1076692939 10:132233037-132233059 CACCAGAAGCTCCCCCAGGAAGG - Intronic
1077467771 11:2741745-2741767 CGCCCGCAGCTGCCCCTGCAAGG - Intronic
1077541374 11:3148043-3148065 CTGCAGAGGCTCCCATTGCATGG + Intronic
1077673761 11:4180330-4180352 GGCCAGAGGATCCCCCTGAGGGG - Intergenic
1078846984 11:15127211-15127233 GGCCTGAGGCTGCTCCTGCAGGG + Intronic
1080970216 11:37265102-37265124 CCCCAAAGGCTCCACATGCAAGG - Intergenic
1082823657 11:57562092-57562114 GGCCTGAGACTCACCCTGCAGGG - Intronic
1083644428 11:64164475-64164497 GGACAGTGGCTCCCCCTCCAGGG + Intronic
1086113171 11:83220082-83220104 CACCAGAGGCTCCCCCTGCATGG - Intronic
1086442863 11:86846589-86846611 TGCCAGAGGCTCCCCCTGCATGG + Intronic
1089582750 11:119491710-119491732 CGCCACAGGCCCCAGCTGCACGG + Intergenic
1089641111 11:119847825-119847847 GGCCAGAGGCTTGCCCTTCAGGG + Intergenic
1090587746 11:128232902-128232924 CCCCAGAGGGTCCCCCCGCCTGG - Intergenic
1094061600 12:26320082-26320104 AGCCAGTGGCTCATCCTGCATGG + Intergenic
1096700664 12:53380589-53380611 CGCCTGAGGCTCCTCCCGCCGGG + Intronic
1098956871 12:76696949-76696971 TGCCAGAGGCTCCCCCTGCATGG - Intergenic
1100330017 12:93572986-93573008 CGCCAGACGCGCCGCCTGCGGGG - Exonic
1101052388 12:100876414-100876436 GGCCACAGTTTCCCCCTGCAGGG + Intronic
1101216975 12:102594963-102594985 CCCCAGAGGCACCTCCAGCAGGG - Intergenic
1102145984 12:110655479-110655501 CGCCAGAGGCCCCACCAGGATGG + Intronic
1102236762 12:111298618-111298640 TGCCAGAGGCTCCCTCTGCCTGG + Intronic
1102650693 12:114440115-114440137 GGCCAGAGGGTCACCCTGCTTGG - Intergenic
1103948590 12:124540248-124540270 CTCCAGTGTCTCCTCCTGCAGGG - Intronic
1104103119 12:125634300-125634322 GGCCTGAGACTCACCCTGCAGGG + Intronic
1104596672 12:130124875-130124897 TGCCAGAGGCTCCCACACCAAGG + Intergenic
1104655005 12:130567782-130567804 GCCGAGTGGCTCCCCCTGCAAGG - Intronic
1104941992 12:132399565-132399587 TGCAAGAGGCCCTCCCTGCAGGG + Intergenic
1105332621 13:19432157-19432179 CATCAGAGGCTCCCTCTGCCCGG + Intronic
1105879065 13:24587620-24587642 CATCAGAGGCTCCCTCTGCCCGG - Intergenic
1105920773 13:24961432-24961454 CATCAGAGGCTCCCTCTGCCCGG + Intergenic
1116326172 14:43535636-43535658 TGCCACAGGCTCCCCCTGCGGGG + Intergenic
1122242977 14:100381517-100381539 AGCCACAGGGGCCCCCTGCAGGG + Exonic
1122284156 14:100640926-100640948 CTCCAGAGGCTTCCTCAGCAGGG - Intergenic
1122740717 14:103870217-103870239 GGCCTGAGACTCCCTCTGCAGGG - Intergenic
1123067743 14:105626928-105626950 CTCCAGAGCTTCCCCCGGCAAGG + Intergenic
1123071762 14:105645653-105645675 CTCCAGAGCTTCCCCCGGCAAGG + Intergenic
1123091426 14:105743929-105743951 CTCCAGAGCTTCCCCCGGCAAGG + Intergenic
1123097196 14:105772270-105772292 CTCCAGAGCTTCCCCCGGCAAGG + Intergenic
1124139756 15:27067160-27067182 CCCCAGATGCTCCCACTGGAGGG - Intronic
1124439860 15:29677984-29678006 CACCCGCGGCTCCCTCTGCATGG - Intergenic
1124890186 15:33725447-33725469 CGCCAGAGACTGCCTGTGCAGGG + Intronic
1125688717 15:41579227-41579249 TTCCAGAGGCTCCCCCACCAAGG - Exonic
1125854195 15:42933430-42933452 ACCCAGAGGCTCCTCCTGGAAGG + Intergenic
1128643548 15:69358478-69358500 CACCAGAGGCTGCCCCTGGACGG - Intronic
1128735876 15:70053655-70053677 CTCCAGAGGCCCACCCTGGAGGG - Intronic
1129231527 15:74199633-74199655 GGCCAGAGGCTCCCCCAGGCAGG - Intronic
1132679035 16:1132225-1132247 CTCCACAGGCTCCAGCTGCAGGG + Intergenic
1133063649 16:3191283-3191305 CGCCAGAGGCTCCTTCCGCAGGG - Intergenic
1134089660 16:11384777-11384799 CGGCAGAGGCTCTGCATGCACGG + Intronic
1136356345 16:29746722-29746744 CCCCACAGGCACCCCCTGCTTGG + Intergenic
1136990488 16:35148657-35148679 TGCCAGGGGCTCCCTCTGCATGG + Intergenic
1137671908 16:50284093-50284115 ACCCAGAGGCACCCCCTGCCCGG - Intronic
1141643412 16:85354737-85354759 CCCCAGAGGCTCCTGCTGCGAGG - Intergenic
1142058718 16:88016227-88016249 CGCCACATGCTTCTCCTGCATGG - Intronic
1142398937 16:89849153-89849175 GGCCAAAGGGCCCCCCTGCAGGG + Intronic
1142758364 17:2028901-2028923 CCCCAGAGGCCCTCCCTGCTTGG - Intergenic
1145214108 17:21039486-21039508 CACCACAGCCTCCCCCTCCAGGG - Intronic
1145760791 17:27424638-27424660 AGTGAGAGGCTCTCCCTGCAGGG + Intergenic
1146886308 17:36473215-36473237 CTCCAGAGGCACCTCCAGCAAGG - Intergenic
1147382394 17:40063339-40063361 CGTCCGAGCCTCCCCCTGGAGGG + Intronic
1147775519 17:42898173-42898195 ATCCAGAGGGTCCCCCTGCCTGG + Intergenic
1148752110 17:49951396-49951418 CTCCAGATGCGGCCCCTGCAAGG + Intergenic
1148779371 17:50112847-50112869 AGCCAGTGGCTGCCCCTGCCGGG + Exonic
1150479253 17:65496919-65496941 CCCCAGGGGCCCACCCTGCACGG - Intergenic
1150636248 17:66915282-66915304 AGGCAGAGGCTCCCCCTCCTGGG - Intergenic
1151311213 17:73293465-73293487 GACCAGAGGCTGCCCCTGGAAGG - Intronic
1151674939 17:75592491-75592513 CGGGAGCGGCTCTCCCTGCAGGG + Intergenic
1151767044 17:76138032-76138054 CGCCAGAAGCCCCCCTTGCCTGG + Exonic
1152080409 17:78183881-78183903 CTCGAGAGGCTGCCCTTGCAGGG - Intronic
1152687550 17:81701978-81702000 GGCCTGGGGCTCCCTCTGCAGGG + Exonic
1153636326 18:7117061-7117083 CGCCTGCGGGTCCCCCTGCCCGG + Intronic
1153971148 18:10228509-10228531 AGCCAGAGCCTCCCCTTGCCTGG + Intergenic
1154078886 18:11234728-11234750 GGTCAGAGGTTCCCTCTGCAGGG + Intergenic
1154144006 18:11851277-11851299 CGCCAGGGGCTGCGCATGCAGGG - Intronic
1160527201 18:79544781-79544803 CTCCGGAGGCTCCCCAGGCAGGG - Intergenic
1160699170 19:497854-497876 CTCCGGGGGCTCCACCTGCAGGG - Exonic
1160800023 19:963478-963500 AGCCAGAGGCTCCTGGTGCAGGG + Intronic
1160874770 19:1291857-1291879 AGGCAGAGGCTCACCCAGCAGGG - Intronic
1161722192 19:5909212-5909234 TGCCGTAGGGTCCCCCTGCAGGG - Exonic
1162682187 19:12353951-12353973 CGACAGAGTCTCCACCAGCAAGG + Intronic
1163565929 19:18051557-18051579 GGCCAGAGGAGCCCCCTGCCTGG + Intergenic
1163612092 19:18306970-18306992 GGCCCGAGGCATCCCCTGCACGG + Exonic
1163830933 19:19546877-19546899 CCCCAGAGGCTCCCCTGCCAGGG - Intergenic
1164189364 19:22900847-22900869 CACCAATGGCTCCCTCTGCATGG + Intergenic
1165893576 19:39128732-39128754 GGACAGAGGCTGCCCCTGGAAGG - Intronic
1166380770 19:42354003-42354025 CGACAGCAGCACCCCCTGCACGG + Exonic
1166769987 19:45275890-45275912 CTGCAGAGGCTCCCCAGGCATGG + Intronic
1167077825 19:47259956-47259978 CGCCAGCGGATCCCTCTGCCAGG - Intronic
925318107 2:2940446-2940468 CCCCAGAGCCTGCCCCTGCCAGG + Intergenic
925386714 2:3467056-3467078 AGCCAGTGGCTCCCCCTGGAAGG - Intronic
926033805 2:9617703-9617725 GGCCAGATGATCCTCCTGCATGG - Intronic
931093685 2:58915606-58915628 GGTCAGAGGCTTCCCCTGCTGGG + Intergenic
932616326 2:73233778-73233800 GGCCAGAGGCTCCTCGTGGATGG - Intronic
933323456 2:80806379-80806401 TGCCACAGGCTCCTCCTACATGG - Intergenic
934946232 2:98543911-98543933 CGCCGGAGGCTCTCCCAGCAAGG - Exonic
935561795 2:104567507-104567529 GGTCAGTGGCTCCCCCTGCCAGG - Intergenic
937340816 2:121089290-121089312 GGCCAGAGCCTGCGCCTGCAGGG - Intergenic
937419044 2:121739407-121739429 GCCCAGAGGCTCCTCCTGGAAGG + Intronic
939884295 2:147664458-147664480 CCCCAGAGGCAGCCCCTGAAAGG - Intergenic
939984120 2:148813728-148813750 CGGCAGGGGCACCCCCTCCAGGG - Intergenic
944383698 2:199141285-199141307 GGCCAGAGCCTCCCACTCCATGG + Intergenic
946416914 2:219544283-219544305 CGCCAGAGGCTCCAACTGACTGG - Exonic
948436121 2:237955789-237955811 CGGGTGAGGCTCCGCCTGCAGGG - Intergenic
949070770 2:242022750-242022772 CCCCAGAGTCTCCAGCTGCAAGG - Intergenic
1173084674 20:39904471-39904493 CCCCTGAGTCTCCCCATGCAGGG + Intergenic
1175810909 20:61856829-61856851 CCCCAGGGGCTCCCCGAGCAAGG + Intronic
1176123640 20:63465424-63465446 GGACAGAGCCTCCTCCTGCAGGG + Intronic
1176145106 20:63562042-63562064 AGCCTGCGGCTCCCCCGGCATGG + Intronic
1176215479 20:63945771-63945793 CCCCCGAGGCCCCCTCTGCAGGG + Intronic
1176215977 20:63947942-63947964 CCCCAGAGGCTGCCCCTCCCAGG - Intronic
1176740400 21:10596381-10596403 CATCAGAGGCTCCCTCTGCCCGG - Intronic
1179571233 21:42280008-42280030 CGCCAGGGGCTCACCCCTCAGGG - Intronic
1180092563 21:45540491-45540513 AGCCAGAGTCTCCGCCAGCAAGG + Intronic
1181553808 22:23656068-23656090 GGGCGGAGGCTCCCTCTGCAGGG - Intergenic
1181595015 22:23908464-23908486 TGCCAGAGGCTGGCCCTGCCAGG - Intergenic
1181772362 22:25135154-25135176 TGCCAGTGGCTTTCCCTGCATGG + Intronic
1182692859 22:32175973-32175995 CGCCAGCGCCTCCCCCTCCCCGG - Intergenic
1183831621 22:40421124-40421146 AGCCTGAGGCTGCCCCTGAATGG - Intronic
1184849470 22:47112110-47112132 CGTCAGAGGCACGCCCTGCTAGG + Intronic
1185192843 22:49449818-49449840 CGGGAGAGGGTCCCCCTGCCTGG + Intronic
954579768 3:51696914-51696936 GGCCTGAGGCTGCCCCTCCAGGG + Intronic
954903965 3:54043968-54043990 AGCCAGAGCCTCACCATGCAGGG + Intergenic
955911522 3:63863733-63863755 CGCCACACGCGCCCGCTGCACGG - Intronic
956557808 3:70541503-70541525 CTCCAGAGGCACCTCCAGCAGGG - Intergenic
957445245 3:80308031-80308053 TGCCAGAGGCTCCCCCTGCAGGG + Intergenic
957916761 3:86695938-86695960 CACCAGAGGCTCCCCCTGCAGGG - Intergenic
958467003 3:94471442-94471464 CTCCAGAGGCACCTCCAGCAGGG - Intergenic
959835751 3:110916716-110916738 CCCCCGAGGCACCCCCAGCAGGG - Intergenic
960120986 3:113948267-113948289 CGGGAGAGGCGCACCCTGCAAGG + Intronic
961336678 3:126184536-126184558 GGGCAGAGGCTCTCTCTGCAGGG - Intronic
961632491 3:128311563-128311585 GGCCTGAAGCTCCCCATGCATGG - Intronic
961765526 3:129207563-129207585 CTCCAGAGGCTGCCTTTGCAAGG + Intergenic
964223033 3:154368157-154368179 CGCCAGAGGCTCCCCCTGCAAGG + Intronic
964341498 3:155713321-155713343 CTCCAGAGGCTCCTGCTGGAGGG - Intronic
964383865 3:156126504-156126526 CCCAAGAGGCTCCCCCTCCTTGG - Intronic
964474263 3:157084441-157084463 CTTCAGTGGCTCCCCGTGCATGG - Intergenic
964917246 3:161852949-161852971 CGCCAGAGGCTCCCCCTGCATGG - Intergenic
969376231 4:6765164-6765186 AGCCAGCAGCTCCTCCTGCAAGG + Intergenic
969504155 4:7573831-7573853 CTTCAGGGGCTCCCCATGCAGGG + Intronic
969564591 4:7970559-7970581 CCCCAGAGGCTCCCACAGCCTGG - Intronic
970108961 4:12616553-12616575 CTCCAGAGTCTGCCCCTGCTGGG + Intergenic
972021660 4:34323389-34323411 GGCCTGAGACTCACCCTGCAGGG - Intergenic
972632913 4:40857289-40857311 CGCCAGATGCTCCAGCTGCTAGG + Intronic
975001140 4:69224279-69224301 CTCCAAAGGCTCTCCCTGCAAGG - Intergenic
975004303 4:69267990-69268012 CTCCAAAGGCTCTCCCTGCACGG + Intergenic
975012713 4:69376955-69376977 CGCCAAAGGCCTCCCCTGCAAGG + Intronic
975723225 4:77268174-77268196 GGCCTGAGGCTCAGCCTGCAGGG + Intronic
979919692 4:126480790-126480812 ACCCAGAGGCACCCCCAGCAGGG + Intergenic
981697197 4:147570803-147570825 GACCAGAGGCTCCCCCTCCTGGG + Intergenic
985002478 4:185499816-185499838 CCCAACAGGCTCCCCCTGCTAGG - Intergenic
985785021 5:1888843-1888865 CTCCAGGGGCTCCCCCGGGAAGG + Intergenic
988528721 5:32008906-32008928 CGCCAGCAGCTCCCTCTGCTGGG - Intronic
998252085 5:140560333-140560355 CTTCAGAGAGTCCCCCTGCATGG + Exonic
999270003 5:150291359-150291381 CTCCACAGCCTTCCCCTGCAGGG - Intergenic
1002047849 5:176552102-176552124 GGCCTGAGGCTGCCCCAGCAGGG + Intronic
1006113031 6:31760228-31760250 CGCCAGAGGCCCAGGCTGCAGGG - Intronic
1006451751 6:34109423-34109445 CTCCAGAGGCAGCCCCTGCAGGG - Intronic
1007715745 6:43855082-43855104 CTCCAGAGGCTCCCTCCCCAGGG + Intergenic
1012113122 6:95261309-95261331 TCCCAGAGGCACCCCCAGCAGGG - Intergenic
1013960113 6:115889327-115889349 TGCCTGAGCCTCCCCCTCCATGG + Intergenic
1014201949 6:118618151-118618173 CACCAGAGGCTCCCACAGCATGG + Intronic
1015114741 6:129635485-129635507 CGGCAGAGGCTGGCCCTGCATGG + Intronic
1015891650 6:137975916-137975938 CGACTGAGGCTCCAACTGCATGG - Intergenic
1017539008 6:155380624-155380646 TGCCATAGGCTCCCGCTGCAGGG + Intergenic
1017545836 6:155450145-155450167 CTCCTGGGGCTCCCCCAGCAGGG - Intronic
1017817826 6:158028030-158028052 CCCAAGATGCTCCCCCTGCCTGG - Intronic
1018996276 6:168712681-168712703 GGCCAGTGACTCCCACTGCAGGG - Intergenic
1019409085 7:898842-898864 CGCCAGAGCCCCCCCATCCACGG + Exonic
1023054873 7:36283366-36283388 CCGCAGAGGCTTCCCCTCCAGGG + Intronic
1023938727 7:44756967-44756989 TGCCAGAGGGACTCCCTGCAGGG - Exonic
1026353766 7:69539847-69539869 CGCAAGAGGCTTCTCCTACATGG + Intergenic
1028890821 7:95986741-95986763 GGCCAGAGCCTCTCCCTGAAAGG - Intronic
1034192740 7:149224144-149224166 CGGCGGAGCCTCCTCCTGCACGG + Exonic
1034885338 7:154794425-154794447 TGCCAGAGGCGCCCCGTGCCTGG + Intronic
1037821526 8:22137453-22137475 GGCCAGAGCCTCGCCCTGCTGGG - Intergenic
1037860626 8:22403050-22403072 CACCACAGGCTCTGCCTGCAGGG + Intronic
1038134712 8:24772856-24772878 AGCCAGAGGCTGCACCTGCTGGG + Intergenic
1039885874 8:41653751-41653773 CGCCAGAGGCCACCCCGGCCCGG - Intronic
1043755572 8:84000011-84000033 AGCCAGAGGATCAACCTGCATGG - Intergenic
1045929586 8:107606040-107606062 CGCCAGAGGCTCCCCCTGCACGG - Intergenic
1048780004 8:137990103-137990125 CGTCAGAGGCTCCCCCTGCATGG + Intergenic
1049279003 8:141734679-141734701 GGCCAGAGGCTGCCCCTCCGTGG - Intergenic
1049656470 8:143800798-143800820 CGCCGCAGGCTCGCCCTGCCGGG - Intronic
1055120903 9:72659556-72659578 CACCACAGGCTCCCCCTTCCAGG - Intronic
1056932801 9:90892788-90892810 CGGCAGAGGCCCCCACTGGAGGG - Intronic
1057249724 9:93491093-93491115 GGCCAGGGGCTCACCCTGCGTGG + Intronic
1059401052 9:114070925-114070947 GGCCTGAGGCTCCCCTTGCCTGG - Intronic
1059540392 9:115124721-115124743 AGCCAGAAGCTCCCTCGGCAGGG + Intergenic
1060169983 9:121453464-121453486 AGTCAGAGCCTCCCCCTGCCTGG - Intergenic
1060414396 9:123420400-123420422 CTCCAGAGGCGCCACCTGCGAGG + Intronic
1060549031 9:124476561-124476583 CGCCAGCAGCTCCCCCTCCCTGG - Intronic
1060771712 9:126336792-126336814 CCCGAGAGGCTCCCTCGGCAAGG - Intronic
1061638312 9:131929492-131929514 CGCCTGAGACTCACCCTTCAGGG - Intronic
1062339848 9:136089191-136089213 ACCCAGAGCCTCCCCCTGCCAGG + Intronic
1062550890 9:137086090-137086112 CGCCCGAGGCCCTCCCTGCCTGG - Intergenic
1187181482 X:16947041-16947063 CGCCAGAGTCGCCCCCGGCACGG + Exonic
1192863787 X:75107971-75107993 GGCCAGAGACTCACCCTTCAGGG - Intronic
1193098361 X:77578913-77578935 GGCCAGAGACTCACCCTTCAGGG - Intronic
1193462924 X:81811442-81811464 CACCAGAGGCTCCTCCTGCAAGG - Intergenic
1194780755 X:98023014-98023036 GGCCAGAGACTCACCCTTCAGGG + Intergenic
1195853734 X:109309033-109309055 CCCAAGAGGCACCTCCTGCAGGG - Intergenic
1196564517 X:117189255-117189277 GGCCAGAGACTCACCCTTCAGGG - Intergenic
1198530501 X:137546849-137546871 ACCCAGAGGCTCCCCCCGGAAGG - Intergenic
1199791199 X:151156829-151156851 CTCCAGAGGCTGCCCATGCGTGG - Intergenic
1201750229 Y:17423473-17423495 TGGCAGAGGCTCCCCCTGCAAGG - Intergenic
1201982031 Y:19918453-19918475 TGCCAGTGGCTCCCCCAGCATGG - Intergenic
1202598680 Y:26570260-26570282 CATCAGAGGCTCCCCCTGCCTGG - Intergenic