ID: 964229172

View in Genome Browser
Species Human (GRCh38)
Location 3:154442883-154442905
Sequence GAACCCTGGCTTATAGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964229165_964229172 30 Left 964229165 3:154442830-154442852 CCACACTGCTGGTAATCGAAGGG No data
Right 964229172 3:154442883-154442905 GAACCCTGGCTTATAGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964229172 Original CRISPR GAACCCTGGCTTATAGGGAC AGG Intergenic
No off target data available for this crispr