ID: 964232664

View in Genome Browser
Species Human (GRCh38)
Location 3:154488478-154488500
Sequence ATCTGATGCTATGTGTCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964232664_964232668 -2 Left 964232664 3:154488478-154488500 CCCCAAGACACATAGCATCAGAT No data
Right 964232668 3:154488499-154488521 ATTCTGCAAGGTTGAAATGAAGG No data
964232664_964232670 29 Left 964232664 3:154488478-154488500 CCCCAAGACACATAGCATCAGAT No data
Right 964232670 3:154488530-154488552 TTAAAGGCAGCCAGAGAGAAAGG 0: 162
1: 7008
2: 3352
3: 1562
4: 1263
964232664_964232669 13 Left 964232664 3:154488478-154488500 CCCCAAGACACATAGCATCAGAT No data
Right 964232669 3:154488514-154488536 AATGAAGGAAAAAATGTTAAAGG 0: 6410
1: 2808
2: 1234
3: 712
4: 2025

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964232664 Original CRISPR ATCTGATGCTATGTGTCTTG GGG (reversed) Intergenic
No off target data available for this crispr