ID: 964237567

View in Genome Browser
Species Human (GRCh38)
Location 3:154550852-154550874
Sequence CCCTGTCAATTTAGTTCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964237567_964237569 13 Left 964237567 3:154550852-154550874 CCAGCAGAACTAAATTGACAGGG No data
Right 964237569 3:154550888-154550910 TCTGCTACATAAGACAGATCTGG No data
964237567_964237572 30 Left 964237567 3:154550852-154550874 CCAGCAGAACTAAATTGACAGGG No data
Right 964237572 3:154550905-154550927 ATCTGGCCAAATCTGGATTTGGG No data
964237567_964237571 29 Left 964237567 3:154550852-154550874 CCAGCAGAACTAAATTGACAGGG No data
Right 964237571 3:154550904-154550926 GATCTGGCCAAATCTGGATTTGG No data
964237567_964237570 23 Left 964237567 3:154550852-154550874 CCAGCAGAACTAAATTGACAGGG No data
Right 964237570 3:154550898-154550920 AAGACAGATCTGGCCAAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964237567 Original CRISPR CCCTGTCAATTTAGTTCTGC TGG (reversed) Intergenic