ID: 964239312

View in Genome Browser
Species Human (GRCh38)
Location 3:154573517-154573539
Sequence AGTTAGTGGAGGAAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964239308_964239312 8 Left 964239308 3:154573486-154573508 CCAAATAAACTATCGATGTTAAT No data
Right 964239312 3:154573517-154573539 AGTTAGTGGAGGAAGATGGCAGG No data
964239306_964239312 15 Left 964239306 3:154573479-154573501 CCTTGACCCAAATAAACTATCGA No data
Right 964239312 3:154573517-154573539 AGTTAGTGGAGGAAGATGGCAGG No data
964239307_964239312 9 Left 964239307 3:154573485-154573507 CCCAAATAAACTATCGATGTTAA No data
Right 964239312 3:154573517-154573539 AGTTAGTGGAGGAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964239312 Original CRISPR AGTTAGTGGAGGAAGATGGC AGG Intergenic
No off target data available for this crispr