ID: 964240875

View in Genome Browser
Species Human (GRCh38)
Location 3:154593199-154593221
Sequence CACAGAGGAGATTTTAAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964240871_964240875 24 Left 964240871 3:154593152-154593174 CCTTCTAATTGGTGTTGTTTTCA No data
Right 964240875 3:154593199-154593221 CACAGAGGAGATTTTAAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964240875 Original CRISPR CACAGAGGAGATTTTAAGTC AGG Intergenic