ID: 964242811

View in Genome Browser
Species Human (GRCh38)
Location 3:154616306-154616328
Sequence CTCAGGGATGTGCCCACTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964242811_964242819 29 Left 964242811 3:154616306-154616328 CCTACAGTGGGCACATCCCTGAG No data
Right 964242819 3:154616358-154616380 AGACATGAAAAACATCCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964242811 Original CRISPR CTCAGGGATGTGCCCACTGT AGG (reversed) Intergenic
No off target data available for this crispr