ID: 964244363

View in Genome Browser
Species Human (GRCh38)
Location 3:154633589-154633611
Sequence ATACCACACCACCACGGCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964244359_964244363 0 Left 964244359 3:154633566-154633588 CCGAGCACACAGAAATGCTTTCC No data
Right 964244363 3:154633589-154633611 ATACCACACCACCACGGCAAGGG No data
964244355_964244363 6 Left 964244355 3:154633560-154633582 CCCTCCCCGAGCACACAGAAATG No data
Right 964244363 3:154633589-154633611 ATACCACACCACCACGGCAAGGG No data
964244357_964244363 2 Left 964244357 3:154633564-154633586 CCCCGAGCACACAGAAATGCTTT No data
Right 964244363 3:154633589-154633611 ATACCACACCACCACGGCAAGGG No data
964244354_964244363 26 Left 964244354 3:154633540-154633562 CCTCATAATTGCTGTGTGCTCCC No data
Right 964244363 3:154633589-154633611 ATACCACACCACCACGGCAAGGG No data
964244356_964244363 5 Left 964244356 3:154633561-154633583 CCTCCCCGAGCACACAGAAATGC No data
Right 964244363 3:154633589-154633611 ATACCACACCACCACGGCAAGGG No data
964244358_964244363 1 Left 964244358 3:154633565-154633587 CCCGAGCACACAGAAATGCTTTC No data
Right 964244363 3:154633589-154633611 ATACCACACCACCACGGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964244363 Original CRISPR ATACCACACCACCACGGCAA GGG Intergenic
No off target data available for this crispr