ID: 964250536

View in Genome Browser
Species Human (GRCh38)
Location 3:154711212-154711234
Sequence CCTCATCAGATCCCATGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964250530_964250536 19 Left 964250530 3:154711170-154711192 CCAGTATTCTGTTTTCTCTCTTG No data
Right 964250536 3:154711212-154711234 CCTCATCAGATCCCATGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964250536 Original CRISPR CCTCATCAGATCCCATGGAT GGG Intergenic
No off target data available for this crispr