ID: 964255018

View in Genome Browser
Species Human (GRCh38)
Location 3:154766335-154766357
Sequence TGGGATGACCAGCAGCAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 917
Summary {0: 4, 1: 38, 2: 98, 3: 250, 4: 527}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964255018_964255023 2 Left 964255018 3:154766335-154766357 CCCCTCTGCTGCTGGTCATCCCA 0: 4
1: 38
2: 98
3: 250
4: 527
Right 964255023 3:154766360-154766382 GTCTCCTGCTGTCAACAGAGAGG No data
964255018_964255024 3 Left 964255018 3:154766335-154766357 CCCCTCTGCTGCTGGTCATCCCA 0: 4
1: 38
2: 98
3: 250
4: 527
Right 964255024 3:154766361-154766383 TCTCCTGCTGTCAACAGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964255018 Original CRISPR TGGGATGACCAGCAGCAGAG GGG (reversed) Intergenic
900074779 1:804752-804774 TGGGAAAAACATCAGCAGAGAGG - Intergenic
900235251 1:1586246-1586268 CAGGATGACCAGCTGCAGAGAGG + Intergenic
900792535 1:4689840-4689862 GCGGATGCCCAGCAGCAGAGGGG + Intronic
901403528 1:9031314-9031336 CAGGATGACCAGCTGCAGAGAGG - Intergenic
901936636 1:12631253-12631275 CTGGATGACCAGCTGCAGAGAGG + Intergenic
901965707 1:12864075-12864097 TAGGAAGACCAGTGGCAGAGAGG + Intronic
901981106 1:13034453-13034475 TAGGAAGACCAGTGGCAGAGAGG + Intronic
902000981 1:13194477-13194499 TAGGAAGACCAGTGGCAGAGAGG - Intergenic
902020211 1:13340181-13340203 TAGGAAGACCAGTGGCAGAGAGG - Intergenic
902049364 1:13549651-13549673 AGGGATGATTAGCAGGAGAGAGG + Intergenic
903101774 1:21035970-21035992 CAGGATGACCAGCTGTAGAGAGG + Intronic
903229253 1:21911802-21911824 TGGGCTGGCCGGCAGCTGAGGGG - Intronic
903311867 1:22465331-22465353 TGGGATGACTAGCTACAGAGAGG - Intronic
903337492 1:22634905-22634927 TTGGATGACCAGCTGCCGAGAGG - Intergenic
903380043 1:22890368-22890390 TGGGTGGGGCAGCAGCAGAGAGG - Intronic
903672122 1:25042784-25042806 TAGGATGACCAGCTGTAGAGAGG - Intergenic
904009388 1:27381161-27381183 GGGGATGAGGAGCAGAAGAGGGG + Intronic
904365709 1:30009905-30009927 TGGGATGACCAGCTGCAGAGGGG - Intergenic
904370118 1:30042904-30042926 TGGGATGACCAGCTGCAGACAGG + Intergenic
904403938 1:30274291-30274313 TGGGAGAACCAGCTGCAGAGGGG - Intergenic
904461068 1:30680074-30680096 TGAGACAACCAGCTGCAGAGAGG + Intergenic
904577391 1:31513900-31513922 TGGGATGACTAGCAGCAGAGAGG - Intergenic
904577396 1:31513951-31513973 TGGCACAACCAGCTGCAGAGAGG - Intergenic
904682493 1:32239326-32239348 TGAGATGAGCAGCAGCGCAGAGG - Intergenic
904850383 1:33454862-33454884 TGCTCTGCCCAGCAGCAGAGTGG + Intergenic
905001313 1:34671882-34671904 TGGGATGACCAACTTCAGAGAGG + Intergenic
905001336 1:34672075-34672097 TGGGATGACCACCTGCAGAGAGG + Intergenic
905001350 1:34672151-34672173 AAGGATGACCAGCTGCAGAGAGG + Intergenic
906082390 1:43101916-43101938 TGGGCAGACCAGCTGCAGAAAGG - Intergenic
906854795 1:49292552-49292574 GGGGATGACTAGCTGCAGAGAGG + Intronic
906854801 1:49292622-49292644 TGTGATGACCAGCTGCAAAGAGG + Intronic
907152984 1:52306256-52306278 CGGGATGACCAGCTGCAGAGAGG + Intronic
907152993 1:52306324-52306346 TGAGATGACCAGCTGTAGAGAGG + Intronic
907252947 1:53155164-53155186 CTGGATGATCAGCTGCAGAGAGG + Intergenic
907369603 1:53992413-53992435 TGAGACAACCAGCTGCAGAGAGG - Intergenic
907369612 1:53992482-53992504 TGGGATGACCAGTTGAAGAGAGG - Intergenic
907761847 1:57368505-57368527 CTGGATGACCAGCTGCAGAGAGG + Intronic
907783349 1:57587648-57587670 TAAGCTGACCTGCAGCAGAGTGG - Intronic
908259296 1:62327311-62327333 CAGGAAGACCAGCTGCAGAGAGG - Intergenic
908831143 1:68179750-68179772 TGGGAAGACCAGATGCAAAGAGG - Intronic
908925079 1:69244310-69244332 TGCTCTGGCCAGCAGCAGAGAGG - Intergenic
909238272 1:73180639-73180661 TGGGAGGAGCAGTTGCAGAGAGG - Intergenic
909282340 1:73771036-73771058 TGGGATAACCAGCTGCAGAGAGG + Intergenic
909652392 1:77990257-77990279 TGGGATGACCAGCATTTAAGGGG - Intronic
910015406 1:82517676-82517698 TGGGGTGGCCAGCAGTTGAGGGG - Intergenic
910259901 1:85284505-85284527 TGGGACTACCAGCTGCAGAGAGG + Intergenic
910602103 1:89043304-89043326 TGGGACTACCAGCTGCAGATAGG - Intergenic
910654915 1:89609776-89609798 TGGGATGACCAGCTGCAGAGAGG - Intergenic
910654925 1:89609846-89609868 TGGGATGACCCGCTACAGAGAGG - Intergenic
911025043 1:93427081-93427103 CAGGATGACCAGCTGCAGAGAGG + Intergenic
911025053 1:93427149-93427171 TGGGACGACCAGCTGCAGAGAGG + Intergenic
911025063 1:93427219-93427241 TGGGATAACCAGCTGCAGAAAGG + Intergenic
911275582 1:95853909-95853931 TGGGATGACCAGCTGCAGAGAGG + Intergenic
911540054 1:99146864-99146886 TTGGGTGACCAGCTGCAGAGAGG + Intergenic
911680442 1:100709459-100709481 TGGTAAGACCAGCAGTGGAGGGG - Intergenic
911876574 1:103171294-103171316 TGTAATGAGCTGCAGCAGAGGGG + Intergenic
912498571 1:110106929-110106951 TGGGGTCTCCAGCAGCATAGTGG + Intergenic
912942994 1:114061331-114061353 CAGGATGACCAGCTGCAGAGAGG + Intergenic
913115342 1:115691720-115691742 TGGGCTGACCAGAAGCAACGGGG - Exonic
913353492 1:117890192-117890214 TGGGGTGAGAAGGAGCAGAGTGG + Intronic
914392697 1:147236600-147236622 TGGGACAACCAACTGCAGAGAGG - Intronic
914392717 1:147236741-147236763 TGGGATAACCAGCCGCAGAGAGG - Intronic
914793929 1:150903834-150903856 TGGGATGTCCGGCTTCAGAGTGG + Intergenic
915163273 1:153934047-153934069 GGGGAAGACCAGAAACAGAGTGG - Intronic
915185065 1:154098530-154098552 TGGGATGACCAGCAGCAGAGAGG - Intronic
915191870 1:154157604-154157626 AGGGAGGAGCAGCAGCAGGGTGG + Intronic
915313519 1:155016150-155016172 TGGGATGACCAGGAGGAGCCAGG + Intronic
916648802 1:166816385-166816407 TGGAATGACCAGCATCAGAGAGG - Intergenic
916648807 1:166816438-166816460 CAAGATGACCAGCTGCAGAGAGG - Intergenic
917159839 1:172045043-172045065 TGGGATGACCAAAGGCAAAGAGG + Intronic
917959619 1:180131994-180132016 TTGGGGGACCAGCAGCAAAGTGG + Intergenic
918963193 1:191306580-191306602 TAGGACGACCAACTGCAGAGAGG - Intergenic
919083218 1:192891235-192891257 TGGGACTACCAGCTGCAGAGAGG - Intergenic
919083224 1:192891301-192891323 TGGGATGATCAGCTGCAGAGAGG - Intergenic
919083229 1:192891346-192891368 CAGGATGACCAGCTGCAGAGAGG - Intergenic
919232935 1:194799152-194799174 TGTGATTACCAGGAGCAGAGAGG + Intergenic
920226298 1:204441654-204441676 TGGGTGGACCGGCAGCAGCGGGG - Intronic
921097831 1:211902049-211902071 CAGGATGATCAGCTGCAGAGAGG + Intergenic
921097838 1:211902117-211902139 CAGGATGACCAGCTGCAGAGTGG + Intergenic
921097849 1:211902185-211902207 TGGGACAACCAGCTGCAGAGAGG + Intergenic
921097859 1:211902258-211902280 CAGGATGACCAGCTGCAGAGAGG + Intergenic
921947122 1:220894007-220894029 AGGGATGACTAGGAGCAGGGAGG - Intergenic
922041650 1:221903671-221903693 CAGGAAGACCAGCTGCAGAGAGG - Intergenic
922132774 1:222795661-222795683 TGGGATGAACAGCTGCAGAGAGG + Intergenic
922270623 1:224029657-224029679 TGGGAAAAACATCAGCAGAGAGG - Intergenic
922457772 1:225790715-225790737 TGGGATCACCATCAGGGGAGGGG + Intergenic
922590545 1:226772626-226772648 TGGGATGACCTCCACCAAAGAGG + Intergenic
922861339 1:228818883-228818905 CTGGATGGCCAGCAGCAGAGAGG + Intergenic
923235986 1:232033476-232033498 TGGGAGGACCTGGAGCAGAGGGG - Intronic
923321802 1:232841790-232841812 TGGGAGGAGCAGGAGCAAAGGGG + Intergenic
923868025 1:237961310-237961332 TGGGAAGACTGGAAGCAGAGAGG + Intergenic
924679924 1:246220858-246220880 TGGGACAACCAGCTGCAGAGAGG + Intronic
924679935 1:246220927-246220949 TGGTACTACCAGCTGCAGAGGGG + Intronic
924679946 1:246220998-246221020 TGGGACGACCAGCTGCAGAGAGG + Intronic
1062770014 10:91964-91986 TAGGACAACCAGCTGCAGAGAGG - Intergenic
1064142359 10:12801130-12801152 TGGGATGAAAAGGAGAAGAGGGG + Intronic
1065407898 10:25389283-25389305 TGGGACAACCAACTGCAGAGAGG + Intronic
1065976582 10:30847333-30847355 TGGGACGACCAGTGGCAGAGAGG + Intronic
1066625674 10:37402977-37402999 TGGGATCCCCTGCAACAGAGGGG + Intergenic
1067421838 10:46158959-46158981 TGGGATGCCCAGCTGCAGAATGG - Intergenic
1067507144 10:46865048-46865070 TGGGATGCCCAGCTGCAGAATGG - Intergenic
1067553559 10:47252471-47252493 GGGGATGAACAGCAGGAGAGAGG + Intergenic
1067701515 10:48576330-48576352 TTGGATGACCAGGAGGAGAATGG - Intronic
1067715796 10:48690614-48690636 AGGGACAACCAGCTGCAGAGAGG - Intronic
1067715811 10:48690736-48690758 CTGGATGACCAGCTGCAGGGAGG - Intronic
1068060575 10:52063806-52063828 TGGGATGACCAGCTGCAGAGAGG - Intronic
1068060585 10:52063874-52063896 TGGGATGACCAGCTGCAGAGAGG - Intronic
1068083614 10:52347846-52347868 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1068279858 10:54854599-54854621 CAGGATGATCAGCTGCAGAGAGG - Intronic
1068348499 10:55814011-55814033 CGGGATGCCCAGCTGCAGAATGG + Intergenic
1068720802 10:60243905-60243927 TGGGATCAGGAGCAGCTGAGAGG + Intronic
1068919339 10:62465970-62465992 TGGGATGAGAAGCAGCAGTGGGG + Intronic
1069127314 10:64652443-64652465 TGGGAGGACCCACAACAGAGAGG + Intergenic
1069156301 10:65034876-65034898 TGGGATGACCAGGTACAGAGAGG + Intergenic
1069592989 10:69653239-69653261 TGGGACAATCAGCTGCAGAGAGG + Intergenic
1069732062 10:70623217-70623239 TGGGAGGACCACCTGCAAAGAGG + Intergenic
1070524568 10:77284200-77284222 AGGCATGACCAGAAGAAGAGAGG + Intronic
1070808414 10:79284784-79284806 AGGGAGGCCCAGCAGGAGAGAGG - Intronic
1070859318 10:79638095-79638117 TGGGATGCCCAGCTGCAGAATGG - Intergenic
1070859327 10:79638163-79638185 TGGGACGACCAGCTGCAGAGAGG - Intergenic
1071060863 10:81570197-81570219 TGGGATGACCAGCTGCAGAAAGG - Intergenic
1071272513 10:84020794-84020816 TCAGCAGACCAGCAGCAGAGGGG + Intergenic
1071306097 10:84299971-84299993 TTGGAGGACCAGCAGCAGCCAGG + Intergenic
1071848955 10:89548906-89548928 AGGGATGTACACCAGCAGAGGGG + Intronic
1071886015 10:89951552-89951574 TGGGACAACCAGCTGCAGAGAGG - Intergenic
1071886034 10:89951715-89951737 TGGGACAATCAGCTGCAGAGAGG - Intergenic
1071957112 10:90771082-90771104 CGGGATGACCAGCTGCAGACAGG + Intronic
1071996507 10:91154167-91154189 TGGGATGCTCAGAAGCCGAGTGG + Intergenic
1072753363 10:97999965-97999987 TGGAATGACCAGCTGCAGAGAGG + Intronic
1072838018 10:98737557-98737579 TGGGGTGAGCAGAAGCAGGGTGG - Intronic
1073432807 10:103497636-103497658 GGGAATCACCAGCAGCAGAGTGG - Intronic
1073601867 10:104853718-104853740 TGGGATGATCAGCAGCAGGGCGG + Intronic
1074028794 10:109663913-109663935 TGGGATGACCAGCTACAGAGAGG + Intergenic
1074028820 10:109664098-109664120 TAGGATGACCAACTGCAGGGAGG + Intergenic
1074247910 10:111713477-111713499 CAGGATGACCAGCTCCAGAGAGG - Intergenic
1074247921 10:111713591-111713613 TGGGATGACCAGCTGTAGAGAGG - Intergenic
1074991512 10:118712684-118712706 TGGGACGACCAGCTGCAGAGAGG - Intronic
1074991520 10:118712754-118712776 TGAGATGACCAGCTGCAGAGAGG - Intronic
1075007827 10:118842996-118843018 TGGGATGACCAGCTGCAGGGAGG + Intergenic
1075007837 10:118843066-118843088 TGGGAAGACCAGCTGCAGAGAGG + Intergenic
1075125471 10:119695499-119695521 TGGGATGACCTGCTGCTGATAGG - Intergenic
1075422251 10:122310363-122310385 AGGGCTGACCAGCAACAGTGCGG + Intronic
1075601531 10:123772856-123772878 AGGGATGACCACAACCAGAGAGG - Intronic
1076165451 10:128278718-128278740 CGGGATGAGCAGCAGCATCGTGG - Intergenic
1076372957 10:129966865-129966887 GGGCAGGAGCAGCAGCAGAGGGG + Intergenic
1076380648 10:130022664-130022686 TGGGATGTGCGGCAGCAAAGGGG - Intergenic
1076549116 10:131266785-131266807 AGGGACGACCAGCCACAGAGAGG - Intronic
1076549120 10:131266837-131266859 CAGGATGACCAGCTGCAGAGAGG - Intronic
1076655119 10:132018974-132018996 TGGGATGAGCAGTTACAGAGAGG - Intergenic
1077000491 11:319865-319887 TGGGATGACGATGAGCAGAATGG + Exonic
1077012835 11:386427-386449 CGGGATGACCAGCTGCAGAAAGG + Intergenic
1077012854 11:386549-386571 TGGGTCGACCAACTGCAGAGAGG + Intergenic
1077125486 11:933677-933699 TGAGATGCCCAGCACCAGGGTGG + Intronic
1077844674 11:6012385-6012407 TGGGATGACCAGGTGCAGAGAGG - Intergenic
1077844699 11:6012558-6012580 TGAGATGACCAGCTGCAGGGAGG - Intergenic
1078042738 11:7883786-7883808 CAGGATGACCAGTTGCAGAGAGG - Intergenic
1078042755 11:7883909-7883931 TGAGATGACCAGCTGCAGAGAGG - Intergenic
1078042758 11:7883963-7883985 CTGGATGATCAGCCGCAGAGAGG - Intergenic
1078315127 11:10288486-10288508 TGGGATGACCAGCTGCAGAGAGG - Intronic
1078422503 11:11224060-11224082 TGGGAAGAGCAGGAGCAGAGAGG - Intergenic
1078426463 11:11254705-11254727 TGGAAAGCCCAGCTGCAGAGGGG - Intergenic
1079243218 11:18735347-18735369 TTGGGGGACCTGCAGCAGAGAGG + Intronic
1079361015 11:19770403-19770425 AGGGAGGACCAGCAGCACGGAGG + Intronic
1079710672 11:23679698-23679720 AGGGATGACCAGCTGCGGAGAGG - Intergenic
1079710700 11:23679859-23679881 TGGAACGACCAGCTGCAGAGAGG - Intergenic
1079733270 11:23962348-23962370 CGGGACCACCAGCTGCAGAGAGG + Intergenic
1079882296 11:25943673-25943695 ATGGAAGACCAGCTGCAGAGAGG - Intergenic
1079920575 11:26429086-26429108 TGCGCTTACCAGCACCAGAGAGG - Intronic
1080414651 11:32057982-32058004 TGGGAACAGCAGCAGGAGAGAGG + Intronic
1080583954 11:33665489-33665511 TGGGACAACCAGCAGCAGAGAGG - Intronic
1080966972 11:37224573-37224595 TGGGACAACCAGCTGCAGAAAGG - Intergenic
1081163931 11:39785805-39785827 CAGGATCACCAGCTGCAGAGAGG - Intergenic
1081268625 11:41057792-41057814 TGGGACAACCAGCTGCAGAAAGG + Intronic
1081487138 11:43539711-43539733 GGGGGTTACCAGGAGCAGAGGGG + Intergenic
1083066761 11:59931971-59931993 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1083653843 11:64219714-64219736 TGGGAGGACCAGAGTCAGAGGGG - Intronic
1084001389 11:66296953-66296975 CGGCATGCCCAGCAGCAGAGTGG - Intergenic
1084054913 11:66625798-66625820 TGGGATGTCCAGAGGCCGAGGGG + Intronic
1084462437 11:69303433-69303455 TGGGATGACGATGAGCAGAATGG + Intronic
1084674213 11:70624719-70624741 TGGGGTGTCCAGCAGCAGCCTGG - Intronic
1084768348 11:71326698-71326720 TGGGATGTCCAGCAGACAAGTGG + Intergenic
1084991159 11:72926378-72926400 TGGCATGACCAGTTGCAGAGAGG + Intronic
1084991165 11:72926431-72926453 TGGGATGGCCAGCTGCAGAGAGG + Intronic
1085518865 11:77126660-77126682 TGGGATGACTGAAAGCAGAGTGG + Intergenic
1086092803 11:83020941-83020963 CAGGATGACCAGCTGCAGAGAGG + Intronic
1086319145 11:85627303-85627325 TGGGAGGATCAGAATCAGAGGGG - Intronic
1087896262 11:103589985-103590007 TGGGATGAGGAGCTGGAGAGGGG - Intergenic
1088135685 11:106552831-106552853 TGGGACACCCAGCTGCAGAGAGG + Intergenic
1088135691 11:106552887-106552909 CAGGATGACCAGCTGCGGAGAGG + Intergenic
1088704246 11:112447683-112447705 TGGGACAACCAACTGCAGAGAGG - Intergenic
1089336198 11:117725605-117725627 TGGGCTGAGCAGCAGCTGATCGG - Intronic
1089637900 11:119828081-119828103 TGGGATCTTCAGCAGCAGAGAGG + Intergenic
1089823201 11:121246798-121246820 TGGGATGACCCGCTGCAGAGAGG + Intergenic
1089864209 11:121617585-121617607 TGGGATGAGCAGGAACTGAGCGG - Intronic
1090124854 11:124075234-124075256 TGAGATGACCTCTAGCAGAGAGG - Intergenic
1090124859 11:124075276-124075298 TGGGAGGACCCGCAGCAGAGAGG - Intergenic
1090124869 11:124075343-124075365 TGGGATGACCTGCTGCAGAGAGG - Intergenic
1090124873 11:124075399-124075421 CAGGATGATCAGCAGCAGAGAGG - Intergenic
1090137010 11:124209581-124209603 TGAGATGACCAGCTGCAGAGAGG - Intergenic
1090502539 11:127275525-127275547 TGGAATGTGCAGGAGCAGAGAGG - Intergenic
1090514594 11:127411973-127411995 TGGGACAGCCAGCTGCAGAGAGG - Intergenic
1091292321 11:134448030-134448052 TGCGATGAGAAGGAGCAGAGGGG - Intergenic
1091302933 11:134519185-134519207 TGACATGGCCAGCAGCAGTGAGG + Intergenic
1092337738 12:7648617-7648639 CTGGATGACCAGATGCAGAGAGG - Intergenic
1092501424 12:9051201-9051223 TGGGAAGACCAGCTGCAGAAAGG + Intergenic
1092501432 12:9051264-9051286 CGGGATTACCAGCTGCAGAGAGG + Intergenic
1092501450 12:9051393-9051415 TGGGAAGACCAGCTGCAGAGAGG + Intergenic
1092508139 12:9125060-9125082 TGGGACAACCAGCTGCACAGAGG + Intergenic
1093059555 12:14588948-14588970 TGGGAAGACCAGTAGCAGAAAGG - Intergenic
1093281833 12:17204343-17204365 TGGGATGACCAGCTACAGAGGGG + Intergenic
1093483494 12:19628738-19628760 TGTGAGGACCAGCAGCAGAGGGG - Intronic
1093492987 12:19725956-19725978 TGGGACAACCAGCTGCAGAGAGG - Intergenic
1094018115 12:25885136-25885158 CGGGATTACCAGCTGCAGAAAGG + Intergenic
1094427340 12:30328589-30328611 TGGGATGACCAGCTGTATAGAGG + Intergenic
1095145420 12:38721161-38721183 GGGGTTGACCAGCAGCAGAAAGG + Intronic
1095603236 12:44037908-44037930 TGGGAGTACCAGCTGCAGAGAGG + Intronic
1095826131 12:46531615-46531637 CAGGATGACCATCTGCAGAGAGG + Intergenic
1096602157 12:52737021-52737043 AAGGAGGACCAGCTGCAGAGAGG - Intergenic
1096602901 12:52742712-52742734 AGGGAGGACCAGCTGCAGAGAGG + Intergenic
1097130857 12:56809953-56809975 CGGGACAACCAGCTGCAGAGAGG - Intergenic
1097140660 12:56900172-56900194 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1097298947 12:57997867-57997889 TGGGACAACCAGCTGCAGAGAGG - Intergenic
1097796865 12:63871920-63871942 TGCTATGATCAGAAGCAGAGTGG - Intronic
1098465598 12:70783370-70783392 TGGGACTACCAGCTACAGAGAGG - Intronic
1099574597 12:84362975-84362997 TGGGGTGACCAGCTGCAGAAAGG + Intergenic
1099693419 12:85991181-85991203 TGGATCAACCAGCAGCAGAGAGG - Intronic
1100847930 12:98679206-98679228 TGGGACAACCAGCTGCAGAGAGG + Intronic
1100847940 12:98679276-98679298 CAGGAGGACCAGCTGCAGAGAGG + Intronic
1101833180 12:108275092-108275114 TGGCATGGCAAGCAGCACAGGGG + Intergenic
1102060451 12:109926990-109927012 CGGGACAACCAGCTGCAGAGAGG + Intronic
1103605650 12:122084194-122084216 TGACATGACCAGGAGCAGTGCGG + Intronic
1104673187 12:130694455-130694477 TGAGATCACGAGCAGCAGTGAGG - Intronic
1104738075 12:131152173-131152195 TGGGACTACCAGCTTCAGAGAGG + Intergenic
1104805573 12:131587177-131587199 AAGGACGACCAGCTGCAGAGAGG + Intergenic
1105400909 13:20095124-20095146 TGGGCTAAGCAGCAGCACAGAGG + Intergenic
1105889596 13:24673002-24673024 TGGGATGACCAGGAGAAAACTGG - Intergenic
1106308945 13:28535723-28535745 CGGGATGACCAGCTGCAGAGAGG + Intergenic
1106308965 13:28535894-28535916 CTGGAGGACCAGCAGCAGAGAGG + Intergenic
1106397391 13:29394340-29394362 TGGGACAACTAGAAGCAGAGGGG + Intronic
1106483733 13:30155320-30155342 TGGGGAGACCAGCAGCAGCCAGG - Intergenic
1106537464 13:30660121-30660143 TGGGACGACCAGCAACAGGGAGG - Intronic
1107147077 13:37070500-37070522 CGGGATGACCAGCTGCAGAGAGG + Intergenic
1107147087 13:37070552-37070574 TGGGAGGAACAGCTGCAGAGAGG + Intergenic
1107674356 13:42779170-42779192 GGGGATAAACAGCAGTAGAGTGG + Intergenic
1107875796 13:44789751-44789773 CAGGATGAGCAGCTGCAGAGAGG - Intergenic
1108016982 13:46086478-46086500 GGGGAGGACCAGCTGTAGAGAGG - Intronic
1108262879 13:48675943-48675965 GGGGGTGAGCAGAAGCAGAGTGG - Intronic
1109426260 13:62168593-62168615 TGGGATGATCAGCTGCACGGAGG + Intergenic
1109470672 13:62799729-62799751 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1109562984 13:64076706-64076728 TGGGACTACCAGCTCCAGAGAGG - Intergenic
1109622177 13:64925229-64925251 TGGGACAACCAGCTGCAGAGAGG - Intergenic
1109982307 13:69924425-69924447 TTGGATGGCCAGCTGCAGAAAGG + Intronic
1110008230 13:70297882-70297904 TGGGACGACCAGATGCAGACAGG + Intergenic
1110624494 13:77637632-77637654 GGGGATCACCAGCAGCAGAGGGG - Intronic
1110810691 13:79808084-79808106 TGGGACAACCAGAAGCAGAGAGG + Intergenic
1110939472 13:81330944-81330966 TGGGACAACCAGCTGCAGAGAGG + Intergenic
1110939478 13:81331006-81331028 TGGGACTACCAGCTGCAGAGAGG + Intergenic
1111274891 13:85935673-85935695 TGAGACAACCAGCATCAGAGAGG + Intergenic
1111337202 13:86839836-86839858 TGAAATGACCAGCTGCAGAGAGG - Intergenic
1111337213 13:86839946-86839968 TGAAATGACCAGCTGCAGAGAGG - Intergenic
1111512646 13:89287156-89287178 TGGGATGAGCAGCTGCAGAGAGG - Intergenic
1113218536 13:108071136-108071158 TGGGATGTGCAGAAGCAGGGAGG + Intergenic
1113782509 13:112984859-112984881 AGGGATGGACAGAAGCAGAGCGG - Intronic
1113970716 13:114186134-114186156 TGGGCTGACTAGCTGCAGGGAGG + Intergenic
1113970723 13:114186190-114186212 CAGGATGACCAGCTACAGAGGGG + Intergenic
1114349550 14:21835448-21835470 TGGGACAACCAGCTGCAGAGAGG - Intergenic
1114349557 14:21835516-21835538 CAGGATGACCAGCAGCAGAAAGG - Intergenic
1116131431 14:40859437-40859459 TGGGACAACCAGCTGCAGAGAGG + Intergenic
1116257247 14:42571514-42571536 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1116760905 14:49012360-49012382 TGGGAAAACAAGCAGCAGAGAGG - Intergenic
1117978026 14:61317720-61317742 TGGGATGACAAGCAGTAGCCAGG - Intronic
1118213508 14:63787650-63787672 TGGGACTACCAGTTGCAGAGAGG - Intergenic
1118946990 14:70398115-70398137 TGGGATGACCAGCTCCAGAGAGG - Intronic
1119146021 14:72315010-72315032 TGGTTTGAAGAGCAGCAGAGTGG - Intronic
1119342730 14:73894243-73894265 TTGGATGAACATCAGCAGAGTGG + Intronic
1119400258 14:74358148-74358170 GGGGAGTCCCAGCAGCAGAGAGG - Exonic
1119427026 14:74542321-74542343 TGGGAGTCCCAGCAGCCGAGGGG - Intronic
1119618223 14:76112384-76112406 TGGGTTGGCCAGCTGCAGAGAGG + Intergenic
1120405744 14:84091464-84091486 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1120745529 14:88147631-88147653 GAGGAGGACCAGCTGCAGAGAGG + Intergenic
1121124757 14:91399030-91399052 TGGGAGGACCAGAGGGAGAGTGG - Intronic
1121695321 14:95907866-95907888 CAGGAGGACCAGCTGCAGAGAGG - Intergenic
1121974083 14:98386043-98386065 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1121974089 14:98386096-98386118 TGGGACAACCAGCTACAGAGAGG + Intergenic
1123783997 15:23650498-23650520 TGGGATGACCAACAGCATGGTGG - Intergenic
1124650206 15:31468890-31468912 TGGGATGACCAACTGCAGAGAGG - Intergenic
1124820893 15:33044635-33044657 GAGGATGACCAGCTGCAGAGAGG + Intronic
1124937617 15:34187122-34187144 TGGGACCACCAGCTGCAGAGAGG + Intronic
1125158246 15:36614213-36614235 AGGGAGGAGCAGCAGCAGGGTGG - Intronic
1125238859 15:37550246-37550268 TGAGATGACTAGTTGCAGAGAGG - Intergenic
1125381551 15:39092188-39092210 TGGGATTACCAGCTGCAGAGAGG - Intergenic
1125381562 15:39092258-39092280 CGGGAGGACCAGCTGCAGAGAGG - Intergenic
1125436081 15:39646169-39646191 TGGGAAGACCAGCTGCAGAGAGG + Intronic
1125718144 15:41831185-41831207 TGGGACGACCAGCTGCGGGGAGG + Intronic
1125752398 15:42037370-42037392 CAGGATGACCAGCTGCTGAGAGG + Intronic
1126185696 15:45829170-45829192 TGAGACGGCCAGCTGCAGAGAGG - Intergenic
1126826924 15:52560782-52560804 TGGCATCACCAGGAGCAGAATGG - Intronic
1127525891 15:59791886-59791908 CAGGACGACCAGCTGCAGAGAGG - Intergenic
1128481831 15:68046201-68046223 TGAGACGTCCAGCTGCAGAGAGG + Intergenic
1128496126 15:68199639-68199661 CTGTATGACAAGCAGCAGAGGGG - Exonic
1128790675 15:70431637-70431659 TGGAATGACCAGCTGCAGATAGG - Intergenic
1128847878 15:70917436-70917458 TGGGATAACCAGCTGTAGAGAGG + Intronic
1128847887 15:70917506-70917528 TGGGATGACCATCTGCAGAGAGG + Intronic
1128847894 15:70917576-70917598 TGGGATGACCAGTTGCAAAGAGG + Intronic
1129377704 15:75144677-75144699 CATGATGACCAGCTGCAGAGAGG - Intergenic
1129377708 15:75144733-75144755 TGGGACAACCAGCTGCAGAGAGG - Intergenic
1130028966 15:80295012-80295034 TAGGATGACCAGCTGCAGAGAGG - Intergenic
1132621938 16:871879-871901 AGAGATGAACAGCAGGAGAGGGG + Intronic
1132805710 16:1774175-1774197 TGGGCAGTCCAGCAGCAAAGCGG - Intronic
1132882100 16:2167045-2167067 GGGGATCACCAGCAGCAAAGAGG - Intronic
1132885908 16:2181805-2181827 TGGGAGGACCTGCAGGAGATCGG - Exonic
1136872806 16:33824178-33824200 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1136872813 16:33824234-33824256 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1136922381 16:34343828-34343850 TGGGCTGAGGAGCAGCAGATGGG - Intergenic
1136982192 16:35067978-35068000 TGGGCTGAGGAGCAGCAGATGGG + Intergenic
1137238221 16:46633158-46633180 TGGGATGACCAGCTGCAGAGAGG - Intergenic
1137256424 16:46778624-46778646 CAGGATGATCAGCTGCAGAGAGG + Intronic
1137256431 16:46778677-46778699 TGGGACAACCACCTGCAGAGAGG + Intronic
1137334297 16:47533188-47533210 CGGGATGACTAGCTGCAGAGAGG - Intronic
1137698406 16:50478359-50478381 CTGGACGACCAGCTGCAGAGAGG - Intergenic
1137938221 16:52656063-52656085 AGGGAGGAGCAGCAGCAGGGTGG - Intergenic
1138033513 16:53579988-53580010 TGGGATGACCAGCTACAGAGAGG - Intergenic
1138961867 16:62037064-62037086 TGGGATGAGGGACAGCAGAGTGG + Intergenic
1139338230 16:66248516-66248538 TGGGATGAACAGCAGACGCGTGG - Intergenic
1139389981 16:66601416-66601438 TGGGAGGACCAGGTACAGAGAGG - Intergenic
1139573012 16:67825071-67825093 TGGGGTGACCAGCTGCATACAGG + Intronic
1139592793 16:67942770-67942792 TGGGGGGACCAGCAGCACCGGGG + Intronic
1140399739 16:74661356-74661378 TGGCATGGCCAGCAGCCAAGGGG - Exonic
1141852973 16:86660129-86660151 TGGCATGGCAAGCAGCAGGGGGG - Intergenic
1142173186 16:88633530-88633552 GGGGCTGAGCAGCCGCAGAGGGG - Intergenic
1203099358 16_KI270728v1_random:1291820-1291842 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1203099365 16_KI270728v1_random:1291876-1291898 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1142760583 17:2039842-2039864 TGGGCTGACCAGCTGGTGAGGGG + Intronic
1143409550 17:6700606-6700628 CGGGGTGCCCAGCATCAGAGTGG + Intronic
1144060899 17:11582873-11582895 CAGGATGACCAGCTACAGAGAGG - Intergenic
1144060905 17:11582929-11582951 GGGGACAACCAGCTGCAGAGAGG - Intergenic
1144386297 17:14751620-14751642 TGGGACAACCAGCTGCAGAGAGG + Intergenic
1144714533 17:17424728-17424750 TGGGAAAACCAGCTGCAGAGAGG + Intergenic
1145266917 17:21384034-21384056 TGGGGTGACCATCATTAGAGAGG + Intronic
1145398909 17:22515741-22515763 GGGGATGACCAGAGGCAGGGAGG + Intergenic
1146391657 17:32428669-32428691 TCACATGACCAGCAACAGAGAGG - Intergenic
1146431600 17:32801442-32801464 TGGGTTGTCCAGCAGGGGAGGGG + Intronic
1146459475 17:33033934-33033956 CAGGACGACCAGCTGCAGAGAGG + Intronic
1146459478 17:33033986-33034008 TGAGATGATCAGCTGCAGAGAGG + Intronic
1146559660 17:33857183-33857205 CTGGTTGACCAGCAGCAGAAAGG - Intronic
1148386252 17:47237256-47237278 GGAGATGACCAGCTGCAGAGAGG - Intergenic
1148386269 17:47237336-47237358 GGTGATGACCAGCTGCAGAGAGG - Intergenic
1149160387 17:53686750-53686772 CTGGATGACAAGCTGCAGAGAGG - Intergenic
1149482885 17:57017840-57017862 CAGGATGACCAGTTGCAGAGTGG - Intergenic
1149482890 17:57017894-57017916 CAGGATGATCAGCTGCAGAGAGG - Intergenic
1149884701 17:60328311-60328333 TGGGACCACCAGGTGCAGAGAGG + Intronic
1150529172 17:65958955-65958977 GGGGACAACCAGCTGCAGAGGGG + Intronic
1150951000 17:69802013-69802035 CAGGATGACCAGCTACAGAGAGG + Intergenic
1150951010 17:69802083-69802105 TGGGATGACCAGCTGGAGAGAGG + Intergenic
1150952830 17:69821933-69821955 TGGGATGATCAGCTGCAGGGAGG + Intergenic
1151395267 17:73819193-73819215 TGGGATGACCAGCTGCAGAGAGG - Intergenic
1151576131 17:74953435-74953457 TGGGGTCACCTGCAGCAGAGGGG - Intronic
1151773115 17:76177743-76177765 TGGGACCACCAGCTGCAGAGAGG + Intronic
1151977815 17:77492342-77492364 TGTGATGAGCAGGAGAAGAGAGG + Intronic
1152390571 17:80001626-80001648 TGGGATGGCCAGGAGCTGGGAGG - Intronic
1152483577 17:80573808-80573830 TGGGATGTCCTGGAGTAGAGGGG - Intronic
1152530395 17:80915109-80915131 TGGGAAAACCAGCTGCAGAGAGG + Intronic
1152530403 17:80915179-80915201 CGGGAAAACCAGCTGCAGAGAGG + Intronic
1152530430 17:80915387-80915409 CGGGAAAACCAGCTGCAGAGAGG + Intronic
1152530439 17:80915457-80915479 CGGGAAAACCAGCTGCAGAGAGG + Intronic
1152530470 17:80915667-80915689 CGGGAAAACCAGCTGCAGAGAGG + Intronic
1152530502 17:80915877-80915899 CGGGAAAACCAGCTGCAGAGAGG + Intronic
1152560300 17:81075312-81075334 TGGGGAGACCAGAAGCACAGGGG - Intronic
1152645925 17:81468490-81468512 TGGGAGGACGAGGGGCAGAGAGG - Intergenic
1152864179 17:82712473-82712495 TGGGACTGCCAGCTGCAGAGAGG - Intergenic
1152864189 17:82712543-82712565 TGGAACTACCAGCTGCAGAGAGG - Intergenic
1153139324 18:1954321-1954343 TGGGATGACCACTTGCAGAGAGG - Intergenic
1154150927 18:11905821-11905843 TGTGAATACCACCAGCAGAGAGG + Intronic
1154507975 18:15061145-15061167 AGGGACAACCAGCGGCAGAGAGG + Intergenic
1155120644 18:22816061-22816083 CAGGATGACCAGTTGCAGAGAGG - Intronic
1155120660 18:22816187-22816209 TGGGATGACCAGTTGCAGAGAGG - Intronic
1155120664 18:22816241-22816263 TGGGACGACCAGCTGTAGAGAGG - Intronic
1155830854 18:30513630-30513652 AGGGATGACCTGCTACAGAGAGG - Intergenic
1155830866 18:30513721-30513743 ATGGATAACCAGCTGCAGAGAGG - Intergenic
1156013095 18:32516419-32516441 TGGGCAGACCAGCAGAAGAGAGG + Intergenic
1156160386 18:34351308-34351330 TGGGAGGACCAGCTTCAGAGAGG + Intergenic
1156298756 18:35817593-35817615 GGGGACAACCAGCTGCAGAGAGG - Intergenic
1157042866 18:44060937-44060959 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1158516777 18:58137440-58137462 TGTGAGGACCAGCACCAGTGGGG + Intronic
1158674973 18:59510095-59510117 TGGGAAGGCCAGCTGCAAAGAGG + Intronic
1159028476 18:63208021-63208043 TGGTAGGACCAGGAGCAGATGGG - Intronic
1159186702 18:64984178-64984200 TAGGACAACCAGCTGCAGAGAGG + Intergenic
1159259514 18:65994153-65994175 TGGTATAACCAGAAGCAGGGAGG - Intergenic
1159519055 18:69495476-69495498 TGGGACAACCAGCTGCAGAGAGG - Intronic
1160292859 18:77609654-77609676 CTGGATGACCAGCTGCAGAGAGG + Intergenic
1160292865 18:77609707-77609729 TGGGACGGCCAGCTGCAGAGAGG + Intergenic
1160356262 18:78230281-78230303 TGGGAGCACCAGAGGCAGAGAGG - Intergenic
1161173185 19:2823714-2823736 CCGGACGACCAGCTGCAGAGAGG - Intronic
1161276571 19:3421505-3421527 TGGGCTGGACAGCAGCCGAGGGG - Intronic
1161780214 19:6286707-6286729 CGGGACTACCAGCTGCAGAGAGG + Intergenic
1162395862 19:10417808-10417830 TGGGATCAGCAGCGGCAGGGTGG - Intronic
1162495800 19:11022738-11022760 TGCCTTGACCAGCAGCCGAGAGG - Intronic
1163127787 19:15253625-15253647 TGGCAGGGCCAGCAGCAGACTGG + Intronic
1163366533 19:16878834-16878856 TGCGCTGTCCGGCAGCAGAGGGG - Exonic
1163687013 19:18717470-18717492 TGGGGTGATCAGCTCCAGAGGGG - Intronic
1165022656 19:32936643-32936665 TGAGATGACCAGCTGCAGAGAGG + Intronic
1165022663 19:32936696-32936718 TCAGAGGACCAGCAGCAGAGAGG + Intronic
1165026920 19:32969155-32969177 TGGGGTGACCAGCTACAGAGAGG - Intronic
1165334029 19:35156660-35156682 TGGGATGAGAAGGGGCAGAGTGG + Intronic
1166120842 19:40685278-40685300 TGGGAGCACCAACAGCAGAGGGG + Intronic
1166539823 19:43597604-43597626 TGGGATTAACTGCAGCAAAGGGG + Intronic
1166643929 19:44517162-44517184 TGAGATGATCAGCACCATAGAGG - Exonic
1166897511 19:46033057-46033079 TGGGACAACCAGCTGCAGAGCGG + Intergenic
1166897518 19:46033114-46033136 TGGGATGACCAGCTCCAGGGAGG + Intergenic
1167013199 19:46822234-46822256 TGGGATTACCACCTGCACAGAGG + Intergenic
1167293560 19:48636941-48636963 CGGGCCGCCCAGCAGCAGAGGGG + Exonic
1167346275 19:48947351-48947373 CAGGATGACCAGCTACAGAGCGG + Intergenic
924963907 2:58157-58179 TGGGATGACCAGCTGCAGGGAGG + Intergenic
925048209 2:790320-790342 CTGGATGACCTGCTGCAGAGAGG + Intergenic
925048225 2:790390-790412 TGGGATGACCTGCCACAGAGAGG + Intergenic
926219945 2:10928702-10928724 TGTGATGAGCATCAGAAGAGAGG - Intergenic
926859255 2:17291664-17291686 TGGGATGACTGGCTGCGGAGAGG - Intergenic
926953637 2:18271394-18271416 CGGGAGGACCAGTTGCAGAGAGG - Intronic
926958817 2:18332198-18332220 TGGGATGACCAGCCGTAGAGAGG - Intronic
927020514 2:19011966-19011988 TGGCAAGAGCAGCAGCAGATGGG - Intergenic
927072942 2:19548717-19548739 TGGGATGACCAGCTGCAGAAAGG + Intergenic
927226212 2:20767838-20767860 TGGGATGACCTGCTGCAGAAAGG + Intronic
927226228 2:20767956-20767978 TGGGATGACCAGCTGCAGAGAGG + Intronic
927286839 2:21365897-21365919 GGGGATGAGGAGAAGCAGAGTGG - Intergenic
927533815 2:23836717-23836739 CAGGATGACCAGCTGCAGAGAGG - Intronic
927571538 2:24164822-24164844 AGAGATTGCCAGCAGCAGAGAGG + Intronic
927613538 2:24566298-24566320 TGGGATGACCAGCTGCGGAGAGG - Intronic
927613560 2:24566438-24566460 TAGGATGACCAGCTGTGGAGAGG - Intronic
927743155 2:25590569-25590591 TGGGACAACCAGCTGCAGAGAGG - Intronic
928269592 2:29844278-29844300 TGGCTAGACCAGCAGCAGATGGG + Intronic
928709645 2:33989788-33989810 TGAGATGAGCAGCAAGAGAGAGG + Intergenic
928840511 2:35599353-35599375 CAGGATGACCAGCTGCAGAGAGG + Intergenic
928964759 2:36966105-36966127 TGGGATGGGCGGCAGCAAAGGGG + Intronic
929014602 2:37481872-37481894 TGGGACGACCAGCTGTGGAGAGG + Intergenic
929492482 2:42408445-42408467 CAGGATGACCAGCTGCAGAGAGG + Intronic
930612046 2:53554404-53554426 TGGGATGACCAGCTGCAAAGAGG + Intronic
930612060 2:53554518-53554540 TGGGATGACCAGCTGCAGAAAGG + Intronic
930800586 2:55438657-55438679 TGGGAAAACCAGCTGCAGAGAGG + Intergenic
930800595 2:55438725-55438747 TGGAATGACCAGCTACAGAGAGG + Intergenic
930946615 2:57084112-57084134 TGGGACGACCAACTGCAGAGAGG - Intergenic
931300517 2:60973895-60973917 GGGGACAACCAACAGCAGAGAGG + Intronic
932485345 2:72081148-72081170 TGGGACAGCCAGCTGCAGAGAGG + Intergenic
932501613 2:72187620-72187642 CAGGACGACCAGCTGCAGAGAGG - Intronic
932522472 2:72427929-72427951 TGGGACAACCAGCTGAAGAGAGG + Intronic
933093325 2:78146924-78146946 TGGGATGACTAGCTGCAGAGAGG + Intergenic
933624672 2:84585624-84585646 CGGGAAAACCAGCTGCAGAGGGG - Intronic
933801123 2:85961227-85961249 CAGGATGACCAGCTGCAGAAAGG - Intergenic
934550872 2:95260812-95260834 TGGGATCACCAGCAGCTGATTGG + Intergenic
934699901 2:96430789-96430811 CAGTATGACCAGCTGCAGAGAGG + Intergenic
934780720 2:96968222-96968244 GGGAATGAGCAGGAGCAGAGGGG - Intronic
935506355 2:103909075-103909097 TGAGAAGACCAGCCACAGAGTGG - Intergenic
937163988 2:119794978-119795000 TGGGATAGCCAGCTGCAGAGTGG - Intronic
937164006 2:119795104-119795126 TGGGACAACCAACTGCAGAGAGG - Intronic
937167791 2:119837051-119837073 AGGGATGACCAGAAGCATGGGGG + Intronic
937296163 2:120811145-120811167 TGGCTTGACCAGCAGCACATGGG - Intronic
937543757 2:122989660-122989682 CAGGATGACCAGCTGCAGAGGGG + Intergenic
937884475 2:126890424-126890446 TGGGAGGAACAGCAGAGGAGAGG + Intergenic
938180631 2:129179088-129179110 CAGGATGACCAGCTTCAGAGGGG - Intergenic
938320616 2:130359833-130359855 TGGGAAGCCCAGCAGGAGAGGGG - Intronic
939250814 2:139679977-139679999 TGTGGTTACCAGGAGCAGAGAGG - Intergenic
939466269 2:142561603-142561625 TGGGATGGCCAGCTGCAGCAAGG + Intergenic
939551373 2:143619781-143619803 TCACATGGCCAGCAGCAGAGAGG - Intronic
939586468 2:144012126-144012148 GGGGATGGGCAGCAGGAGAGGGG - Intronic
940396247 2:153195931-153195953 TGGGATGATCAGATGCAGAGAGG - Intergenic
940612174 2:156006254-156006276 TGGGACAACCAGCTGCAGAGAGG - Intergenic
941649462 2:168078389-168078411 TAGGATGAGCAGCCACAGAGAGG + Intronic
942104030 2:172614451-172614473 CGGGATGACCAGCTGCAGAGAGG + Intergenic
942807182 2:179945668-179945690 TGGGAAGACCAGAAGTAAAGAGG - Exonic
942950635 2:181717091-181717113 TGGGATGACCAGCAAGTGGGTGG + Intergenic
943820374 2:192314510-192314532 TGGAATGACCAGCTACATAGAGG - Intergenic
943961236 2:194265342-194265364 TGGGATGACAAGCTGCAGAGAGG + Intergenic
944483855 2:200182669-200182691 TGGGAAAACCAGCTGCAGAGAGG + Intergenic
944586696 2:201179105-201179127 TGGGATGACCAGCTGCAGAGAGG + Intergenic
944901768 2:204223201-204223223 CAGGGTGACCAACAGCAGAGAGG - Intergenic
944901792 2:204223360-204223382 CGGGACGACCGGCTGCAGAGAGG - Intergenic
945056239 2:205871686-205871708 TGGGATATACACCAGCAGAGGGG + Intergenic
945330092 2:208529633-208529655 TGGAATGACCAGCTACAGAGAGG - Intronic
945770373 2:214035137-214035159 TGATAAGACCAGCTGCAGAGAGG - Intronic
946197404 2:218043323-218043345 CTGGATGACCAGCTGCAGAGAGG - Intronic
946197412 2:218043391-218043413 TGGGATGAACAGCTGCAGAAAGG - Intronic
946197422 2:218043503-218043525 TGGGTTGACCAGCTGCAGAGAGG - Intronic
946197432 2:218043571-218043593 GGGGATGACCAGTTGCAGAAAGG - Intronic
947316719 2:228866690-228866712 TGGGACAACCAGCTGCAGAGAGG + Intronic
947327241 2:228992322-228992344 TGGGATGATCAGCTACAGAGAGG - Intronic
947488399 2:230573130-230573152 AGGGAGGAGCAGCAGCAGGGTGG + Intergenic
947622158 2:231597585-231597607 TGGGCCCACCACCAGCAGAGTGG + Intergenic
948476076 2:238220912-238220934 TGGGAAAACAAGCCGCAGAGAGG - Intergenic
948575364 2:238946468-238946490 CAGGATAACCAGCTGCAGAGAGG - Intergenic
948713038 2:239837005-239837027 ATGGATGACCAGCTGCAGAGAGG + Intergenic
948909516 2:240996118-240996140 TGTAATGCCCAGCAGCAGCGGGG + Intergenic
948940180 2:241191423-241191445 TGGGAAGAACAGCAGGAAAGGGG + Intronic
1168837755 20:888982-889004 TGGAGTGACCAGGAGGAGAGTGG - Intronic
1169165858 20:3423464-3423486 TAGGAAAACGAGCAGCAGAGTGG - Intergenic
1170004211 20:11647337-11647359 TGGGAGGACTGGCTGCAGAGAGG + Intergenic
1170495062 20:16915866-16915888 GGGGAAGACCAGTAGCAGAGAGG + Intergenic
1170542950 20:17407213-17407235 TGGGATGTCCAACCTCAGAGAGG - Intronic
1171236875 20:23534690-23534712 CCAGATGACCAGCTGCAGAGAGG - Intergenic
1173179746 20:40796825-40796847 GGGCAGGAGCAGCAGCAGAGTGG - Intergenic
1173207578 20:41006977-41006999 TGGGACAACCAGCTGCAGAAAGG - Intergenic
1173524429 20:43721235-43721257 TGGGACAAACAGTAGCAGAGAGG - Intergenic
1173524435 20:43721289-43721311 AGGGATGACCAGCTGCAGAGAGG - Intergenic
1173605722 20:44329923-44329945 TGGGGTGATCTGCAGAAGAGGGG + Intergenic
1173866543 20:46316179-46316201 TGAGATGACAAGCAGGAGTGAGG + Intergenic
1173884535 20:46445804-46445826 TAGGATGACCAACAGCAGAGAGG - Intergenic
1175064395 20:56272742-56272764 TTGGGTGACCAGCTGCAGAGAGG + Intergenic
1175065128 20:56277638-56277660 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1175065136 20:56277706-56277728 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1175675847 20:60945954-60945976 CAGGATGACCAGCAGCAGACAGG + Intergenic
1175959884 20:62630672-62630694 TGGGACAACCAGCTGCAGAGAGG - Intergenic
1176007298 20:62873103-62873125 TGTGATGGGCAGAAGCAGAGGGG + Intergenic
1176408436 21:6434443-6434465 TGGGATGACCACCTGCAGACAGG + Intergenic
1176408452 21:6434535-6434557 TGGGACAACCAGCTGCAGAGAGG + Intergenic
1176790106 21:13310652-13310674 AGGGACAACCAGCGGCAGAGAGG - Intergenic
1176808613 21:13515627-13515649 GGGGCTGACCAGCAGCTGGGGGG - Intergenic
1176973237 21:15289962-15289984 TGGGACCACCAACTGCAGAGAGG - Intergenic
1176976543 21:15327434-15327456 TGGGATGATCAGCTGCAGAGAGG + Intergenic
1177396048 21:20537852-20537874 CGGGACGACCAGCAGCACAAAGG - Intergenic
1177396067 21:20537985-20538007 TGGGATGATCAGCTGCAGAGAGG - Intergenic
1177677048 21:24314438-24314460 TGAAATGACCAGCAGCAGACTGG + Intergenic
1177989287 21:28018850-28018872 TGGGACAACCAGCGGCAGAGAGG - Intergenic
1178244423 21:30936896-30936918 CGGGATGACCAATGGCAGAGAGG + Intergenic
1178379497 21:32096114-32096136 AGGGATGACAATCAGCTGAGGGG - Intergenic
1178419256 21:32430395-32430417 TGTGATGTCCAGCTGCAGAAAGG - Intronic
1178467051 21:32858568-32858590 CAGGATGACCAGCTGTAGAGAGG - Intergenic
1178947413 21:36959701-36959723 TGGGACTACCAGCTGCAGAAAGG + Intronic
1178971642 21:37183577-37183599 TGGCAAGACCAGCAGAAGAATGG - Intronic
1179683929 21:43042769-43042791 TGGGATGACCACCTGCAGACAGG + Intergenic
1179683945 21:43042861-43042883 TGGGACGACCAGCTGCAGAGAGG + Intergenic
1180178906 21:46109212-46109234 CAGGACGACCAGCTGCAGAGAGG - Intronic
1180178914 21:46109277-46109299 TGGCACGACCAGCTGCAGAGAGG - Intronic
1181273429 22:21674009-21674031 TGGGTTGGCCAGCAGCAGGCAGG + Intronic
1181677609 22:24466853-24466875 TGTTGTGACAAGCAGCAGAGAGG + Intergenic
1182871861 22:33654596-33654618 TGGGAGCACAAGCAGGAGAGAGG + Intronic
1182883866 22:33756702-33756724 GGGGCTGACAAGGAGCAGAGCGG + Intronic
1183024943 22:35058057-35058079 TGGGACAACCAGCTGCAAAGAGG - Intergenic
1183165120 22:36141688-36141710 TGGGATCACCACCAGCATCGTGG - Exonic
1184054239 22:42033759-42033781 TGGGACGACCAGCTGCAGAGAGG - Intronic
1184173893 22:42775139-42775161 CTGGATGACCAGCTGCAGAGAGG + Intergenic
1184433380 22:44454744-44454766 CGAGATGTCCAGCAGGAGAGAGG - Intergenic
1184560872 22:45262338-45262360 TCGGATGACCAGCTGTAGTGAGG - Intergenic
1184869404 22:47225805-47225827 ATGGATGACCAGTTGCAGAGAGG - Intergenic
1185333181 22:50260721-50260743 GGAGATGGACAGCAGCAGAGTGG + Intronic
950953287 3:17023989-17024011 GAGGATGAACTGCAGCAGAGAGG - Intronic
951136193 3:19107114-19107136 TGGGATGACCAGCTGCAGAGAGG - Intergenic
951182250 3:19672142-19672164 GGGGACAACCAGCTGCAGAGAGG - Intergenic
951254387 3:20432375-20432397 TGAGCAGACCTGCAGCAGAGGGG - Intergenic
951562414 3:23981992-23982014 AGGGATGGCCAGCTGTAGAGAGG - Intergenic
951562431 3:23982063-23982085 AGGGATGACCAGCTGCAGAGAGG - Intergenic
951566820 3:24019716-24019738 TGGGATGACCTGCCACAGATAGG - Intergenic
951718440 3:25673727-25673749 TGGGATGACCAGCTGCAGAGAGG - Intergenic
952016162 3:28959340-28959362 TGGGAGGACCAGCTGCAGAGAGG + Intergenic
952269336 3:31816959-31816981 TGGGATGATGAGCTGCAGAGTGG - Intronic
952793372 3:37217822-37217844 TGGGACGACTAGCTGCAGAGAGG + Intergenic
952878767 3:37969956-37969978 TGGCAGGAGGAGCAGCAGAGGGG - Intronic
954099347 3:48357585-48357607 CAGGATTACCAGCTGCAGAGAGG - Intergenic
954099353 3:48357651-48357673 CAGGATGACCAGCTGCAGAGAGG - Intergenic
954498065 3:50983484-50983506 TGGGATGACCAGTTGCAGAGAGG + Intronic
954650864 3:52162091-52162113 TGGGATGATCAGCTACAGAGAGG - Intergenic
954737052 3:52715255-52715277 TGGGACGGCCAGCTGCAGAGAGG + Intronic
955241469 3:57182407-57182429 TGGGACAACCAGTTGCAGAGAGG - Intergenic
955241490 3:57182578-57182600 AGGAATGACCAGCTGCAGAGAGG - Intergenic
955935628 3:64099902-64099924 TGGCACCACCATCAGCAGAGAGG + Exonic
956462275 3:69484690-69484712 CTGGACAACCAGCAGCAGAGAGG - Intronic
956462280 3:69484744-69484766 TGAGAGGACCAGCTGCAGAGAGG - Intronic
956860377 3:73317443-73317465 GAGGATGACGAGGAGCAGAGTGG + Intergenic
957624443 3:82640979-82641001 TGGGACTACCATCTGCAGAGAGG + Intergenic
957705187 3:83770738-83770760 TGGGAGGATCAGCTGCAGGGAGG + Intergenic
957845152 3:85722136-85722158 CAGGATAACCAGCTGCAGAGAGG - Intronic
957845162 3:85722204-85722226 CAGGATAACCAGCTGCAGAGAGG - Intronic
958418769 3:93907391-93907413 TGGGACAACCAGCTGCAGACAGG + Intronic
958636264 3:96750642-96750664 CAGGAGGACCAGCTGCAGAGAGG + Intergenic
958636283 3:96750778-96750800 TGGAATGATCAGCAGCAGAGAGG + Intergenic
958675552 3:97265007-97265029 CAGGATGACCAGCTGCAAAGAGG - Intronic
958675556 3:97265063-97265085 CAGGATGACCAGTTGCAGAGAGG - Intronic
959454611 3:106543401-106543423 TGGGTTGCCCAGCAGCCTAGAGG + Intergenic
959863660 3:111242810-111242832 TAGGATGACCAGCAGCAGAGAGG - Intronic
959863666 3:111242864-111242886 TGGGCAGACCTGCTGCAGAGAGG - Intronic
960011122 3:112835439-112835461 TGGGCCAACCAGCTGCAGAGAGG - Intronic
960333882 3:116392840-116392862 CGGGATGACAAGCTACAGAGAGG + Intronic
960531922 3:118774537-118774559 TGAGATGGCAAGCACCAGAGTGG + Intergenic
960690624 3:120342406-120342428 TGGGGTGACCAGCTGCAGAGAGG + Intronic
961051639 3:123751966-123751988 TGGGCTGAACAGGTGCAGAGTGG + Intronic
961110083 3:124276456-124276478 TGGGGTGACCAGAACCAGTGGGG + Intronic
961318892 3:126058860-126058882 TGTGTTGGCCTGCAGCAGAGGGG - Intronic
961576955 3:127845018-127845040 TGGGAGGACCATAAGAAGAGAGG + Intergenic
961791141 3:129377840-129377862 TGGGACTACCAGCTTCAGAGAGG - Intergenic
962105214 3:132382784-132382806 TGGGGTGACCAGCTGCAGAAAGG - Intergenic
962409052 3:135125434-135125456 AGGAATGACCAGCATCATAGAGG - Intronic
962824500 3:139088269-139088291 TGGGATGACCAGCAGCAGAGAGG - Intronic
962824518 3:139088410-139088432 CAGGATGACCAGCTGCAGAGAGG - Intronic
963454232 3:145523006-145523028 TGTGATGACAAGCTGCAGAGAGG - Intergenic
963483390 3:145904517-145904539 TGGGATAACCAGCTGTAGAGAGG + Intergenic
963805187 3:149714920-149714942 GGTGATGACCAGCTGCAGAGAGG + Intronic
963805195 3:149714957-149714979 TGGGAGGACTAGCTGCAGAGAGG + Intronic
964170579 3:153765493-153765515 TGGGAGCACCAGCAGGAGACTGG - Intergenic
964255018 3:154766335-154766357 TGGGATGACCAGCAGCAGAGGGG - Intergenic
964590666 3:158360034-158360056 TGGGATGACCAATAGCAGAGAGG - Intronic
964791779 3:160460030-160460052 TGGGACAACCAGTTGCAGAGAGG - Intronic
965289951 3:166865677-166865699 TGGTATGATCAGCTGCAGAAAGG + Intergenic
965309863 3:167115424-167115446 GGGGAGGACAAGCTGCAGAGAGG - Intergenic
965793053 3:172410679-172410701 TGGGACTATCAGCTGCAGAGAGG - Intergenic
966256159 3:177918255-177918277 CAGGATGACCAGCTGCAGAGAGG + Intergenic
966271549 3:178112931-178112953 AGAGATGGCCAGGAGCAGAGTGG - Intergenic
966803669 3:183788294-183788316 TGGGAAGGCCAACAGCAGGGAGG - Intronic
967240212 3:187431156-187431178 TGAGATCACCTTCAGCAGAGTGG + Intergenic
967649851 3:191973317-191973339 ATGGGTGACCAGCAGCAGAGAGG - Intergenic
968563919 4:1299382-1299404 TGGGAAGAGCAGCAGCAGCTGGG - Intronic
969194216 4:5547606-5547628 CAGGATGACCAGCTGCAGAGAGG + Intronic
969860420 4:10031497-10031519 TGGGCTGCCCAGGAGCAGAGAGG - Intronic
970122733 4:12775031-12775053 TGGGATCACCAACAGAAGTGAGG - Intergenic
970740689 4:19234231-19234253 TGGGATGACAAGCACTAGGGGGG - Intergenic
971714074 4:30153332-30153354 AGGGAAGAACAGCTGCAGAGAGG - Intergenic
971938779 4:33188547-33188569 TGGGATGACTAGCTGCAGAGAGG - Intergenic
972128700 4:35802290-35802312 TGGGAAAACCAGCTTCAGAGAGG + Intergenic
972358235 4:38302972-38302994 TGGGGCAACCAGCTGCAGAGAGG - Intergenic
972369657 4:38410677-38410699 GCGGAGGAGCAGCAGCAGAGGGG + Intergenic
972801729 4:42482850-42482872 TGGAATGACAAGCAGTAGATTGG + Intronic
972886495 4:43497261-43497283 TCTGACAACCAGCAGCAGAGGGG - Intergenic
972931029 4:44071908-44071930 TGGGAAGACCAGCTGCAGAGAGG - Intergenic
973041169 4:45471963-45471985 TGAGATGACCAACTGCAGGGAGG + Intergenic
973041175 4:45472018-45472040 TAGGATGACCAGCAGCTGACAGG + Intergenic
974308582 4:60174500-60174522 TGGGAAGACTAGTTGCAGAGAGG - Intergenic
975253795 4:72211902-72211924 TTTGAAGACCAGCTGCAGAGAGG - Intergenic
975321365 4:73012334-73012356 AGGGATGACCAACTGCAGAGAGG + Intergenic
975393943 4:73853482-73853504 TGGGAGGGCCAGCAGCGGCGAGG + Intronic
975597759 4:76066568-76066590 TGGGATGACCAGCAGCAGAGAGG - Intronic
975910299 4:79258876-79258898 CTGGATGACCAGCTGCAGAAAGG + Intronic
975910307 4:79258944-79258966 CAGGATGACCAGCTGCAGAGAGG + Intronic
975913700 4:79298030-79298052 TGGGAAGAGCAGCTGCAGAGAGG + Intronic
976700821 4:87966824-87966846 AGGGACAGCCAGCAGCAGAGAGG + Intergenic
976718866 4:88151216-88151238 TGGGAAGATTAGCAGCAGTGAGG + Intronic
976734487 4:88296333-88296355 TAGGACGACCAGCTGCAGACAGG - Intergenic
976815814 4:89148062-89148084 TGGGACAACCAGCTGCAGAGAGG - Intergenic
977359125 4:95981316-95981338 ATGGATGACCAGCTGCAGAGAGG + Intergenic
977471882 4:97452626-97452648 CAAGATGACCAACAGCAGAGAGG + Intronic
977487298 4:97665462-97665484 CAGGATGACCAGCTGCAGAGGGG - Intronic
978229865 4:106385594-106385616 TGGGATAACCAGCTGCAGAGAGG - Intergenic
978249293 4:106610743-106610765 TGGGATGACCAGCTGCAGAGAGG + Intergenic
978498497 4:109384772-109384794 TGGGATAGCCAGATGCAGAGAGG + Intergenic
978644143 4:110908574-110908596 TGGGATGACAGGCAGTAGAGAGG + Intergenic
979023740 4:115540026-115540048 TTAGATTACCAGCAGCAGAAAGG - Intergenic
979145405 4:117240172-117240194 TGGGAGGACCAGCTGCAGAGAGG + Intergenic
979448179 4:120839492-120839514 TGGAATGACCAGCTGCAGAGAGG - Intronic
979649463 4:123113993-123114015 CAGGATGACCAGCAGCAGAGAGG - Intronic
980007624 4:127559582-127559604 TGGGGTGACCAGCTGCAGAGAGG + Intergenic
980306221 4:131064647-131064669 TAGGATGAACAGATGCAGAGAGG - Intergenic
980306239 4:131064787-131064809 TGGGATGATCAGCTGCAGAGAGG - Intergenic
980450246 4:132959919-132959941 TGAGATGGCCAGCTGCAGGGAGG + Intergenic
980701967 4:136442761-136442783 TCAGATGACCAGCAGCAGAGAGG + Intergenic
980750050 4:137076888-137076910 TAGGCTGACCAGCTGAAGAGAGG - Intergenic
981042717 4:140238151-140238173 TGGTGTGACCACCAGCAGAATGG + Intergenic
982158026 4:152540422-152540444 ATGGATGACCAGCTGCAGAGAGG - Intergenic
982545239 4:156724860-156724882 TGGGATGACCAGCTGTGGAGAGG + Intergenic
983038922 4:162901425-162901447 TGGGATGAACACCTGCAGAAGGG + Intergenic
983651497 4:170040727-170040749 TGGGACCACCAGCTGCAGAGAGG + Intergenic
983784597 4:171715696-171715718 CGAGATGACCAGCTGCAGAGAGG + Intergenic
985813741 5:2111193-2111215 GGGCTTGGCCAGCAGCAGAGCGG + Intergenic
986923550 5:12717588-12717610 TGGGACAGCCAGCTGCAGAGTGG + Intergenic
987798886 5:22667280-22667302 CGGGACAACCAGCTGCAGAGAGG - Intronic
987999627 5:25331340-25331362 TGGGATGACCAGCTGCAGAAAGG + Intergenic
988093185 5:26569010-26569032 CAGGAGGACCAGCTGCAGAGAGG - Intergenic
989279136 5:39621603-39621625 AGGGATGACCAGCTGCAGAGAGG - Intergenic
989279149 5:39621717-39621739 TGGGATGGCCAGCTGCAGAGAGG - Intergenic
989520696 5:42396773-42396795 CGGGATGACCAGCTACAGAGAGG + Intergenic
990167564 5:53011453-53011475 AAGGATGACCAGCAACATAGCGG - Intronic
990923441 5:60993634-60993656 TGGGATGACCACCCGCAGAGAGG - Intronic
990923450 5:60993702-60993724 CGGGGTGATCAGCTGCAGAGAGG - Intronic
990981175 5:61603685-61603707 AGGGATGAACTGCAGCTGAGAGG + Intergenic
991107591 5:62861875-62861897 CAGGATGACCAGCTGCAGAGAGG - Intergenic
991107599 5:62861943-62861965 AGGGATGACCAGCTGCAGAGAGG - Intergenic
992693081 5:79259102-79259124 TGGGACAACCAGCTTCAGAGAGG - Intronic
993618001 5:90136726-90136748 TGGGACTACCAGCTGCAGAAAGG - Intergenic
993703314 5:91143473-91143495 AGGGACGACCAGCTGCGGAGAGG - Intronic
994063510 5:95508403-95508425 TGGAATGACCAGCTGGAGAGTGG - Intronic
994449922 5:99929317-99929339 TGGGATGACCAGCCGCAGAGGGG - Intergenic
994641030 5:102410241-102410263 GGGGATGACCAGTTGCAGAGAGG - Intronic
994641037 5:102410295-102410317 AAGGATGACCAGCTACAGAGAGG - Intronic
994719910 5:103368531-103368553 TGGGATAACCAGGAGGAGAGGGG - Intergenic
994790791 5:104223817-104223839 TGGGATGACCAGCTGCAGAGAGG - Intergenic
995742446 5:115369012-115369034 GAGGATGACCAGCTGCAGAGAGG + Intergenic
995744952 5:115393602-115393624 TGGGACCACCAGCTGCAGAGAGG - Intergenic
995744959 5:115393668-115393690 TGGAATTACCAGCTGCAGAGAGG - Intergenic
996170706 5:120287091-120287113 AAGGATGAGCAGCAGCACAGAGG - Intergenic
996234419 5:121108591-121108613 CCGGCGGACCAGCAGCAGAGAGG - Intergenic
998373013 5:141673073-141673095 TGAGATGACCCGCAGCAGCAAGG - Exonic
998792307 5:145778243-145778265 TAGGATTATCAGCTGCAGAGGGG + Intronic
999282880 5:150376399-150376421 TGGGATGACAAGGGGAAGAGAGG - Intronic
999513797 5:152280292-152280314 AGGGATGCTCAGCAGGAGAGTGG - Intergenic
999799383 5:155019393-155019415 GGGGACAACCAGCTGCAGAGCGG - Intergenic
999859943 5:155633987-155634009 TGGGACCACTAGCTGCAGAGAGG + Intergenic
999859951 5:155634040-155634062 TGGGATGACCAGCCGCAGAGAGG + Intergenic
999859966 5:155634152-155634174 TGGGATGAACAGTTGCAGAGAGG + Intergenic
1000426229 5:161093897-161093919 TGGGATGGCCAGCAGCAGAGAGG + Intergenic
1000426238 5:161093977-161093999 TGGGACTACCAGCTGCAGAGAGG + Intergenic
1001083011 5:168680666-168680688 TGAGCTGACCAGCAGCCGAGGGG - Intronic
1001324588 5:170712865-170712887 TGGTATTACCAGTATCAGAGAGG + Intronic
1001811812 5:174634808-174634830 TGGGAAGACCAGCAGCCTGGCGG + Intergenic
1001921713 5:175605811-175605833 TGGGATGACCAGAAGAACAGAGG - Intergenic
1002001849 5:176200481-176200503 TAGGAGAGCCAGCAGCAGAGAGG + Intergenic
1002072385 5:176688001-176688023 TGGGATGACTAGCAGCAGAGAGG - Intergenic
1002252489 5:177938497-177938519 TAGGAGAGCCAGCAGCAGAGAGG - Intergenic
1002689074 5:181037709-181037731 TGGGATGGCCAGCTGCAGAGAGG + Intergenic
1002986247 6:2192043-2192065 TGAGATGACCAGATGCAGAGAGG + Intronic
1002986265 6:2192205-2192227 TGGGATGACCAGCTGCAGAGAGG + Intronic
1003302689 6:4898618-4898640 TGTGATGCCCAGCAGCAGGTGGG + Intronic
1003849148 6:10204005-10204027 TGGGAGGACAAGAGGCAGAGGGG + Intronic
1004279870 6:14271473-14271495 CAGGAAGACCAGCTGCAGAGGGG - Intergenic
1004304515 6:14487803-14487825 CGGGACGACCAGCTGCAGAGAGG + Intergenic
1004520875 6:16359432-16359454 CTGGATGACCAGTTGCAGAGAGG + Intronic
1005021433 6:21423172-21423194 AAGGATGACTAGCTGCAGAGAGG - Intergenic
1005043451 6:21620309-21620331 TAGGATGACCAGCTACAGAGAGG - Intergenic
1006347990 6:33498415-33498437 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1006467079 6:34202378-34202400 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1006500968 6:34458490-34458512 CTCGATGACCAGCTGCAGAGAGG + Intergenic
1006753781 6:36396785-36396807 TGGAATGATCAGCTGCAGAGAGG + Intronic
1006789017 6:36686598-36686620 GGGGAGGGACAGCAGCAGAGGGG - Exonic
1006867578 6:37221978-37222000 TGGGAGGACCAGCTACAGAGAGG - Intronic
1006867585 6:37222032-37222054 TAGGACGACCAGCTGCAGAGAGG - Intronic
1007649978 6:43413228-43413250 CCAGGTGACCAGCAGCAGAGAGG + Intergenic
1007649996 6:43413332-43413354 GGGGACAACCAGGAGCAGAGAGG + Intergenic
1007705389 6:43787631-43787653 AGGGATGAGCAGCAGCCGAGGGG + Intergenic
1008188289 6:48422764-48422786 TGGGATGATCAGCTGCAGAGAGG - Intergenic
1008904375 6:56659926-56659948 TGTGTTGAACAGCAGCAGCGGGG + Intronic
1009610138 6:65930903-65930925 TGGGATGACCAGCTGCAGAGAGG - Intergenic
1009705170 6:67239815-67239837 TGGCATCAGCACCAGCAGAGTGG - Intergenic
1009846871 6:69145775-69145797 CAGGATGACCAGCTGCAGAGAGG - Intronic
1009846878 6:69145845-69145867 CGGGATGAACAGCTGCAGAGAGG - Intronic
1010884068 6:81215349-81215371 CGGGATGACCAGCTGCAGGGAGG + Intergenic
1011284165 6:85706119-85706141 TGGGACTACCAGCAGCAGGAAGG - Intergenic
1011530128 6:88312423-88312445 TGGGACAACTGGCAGCAGAGAGG - Intergenic
1011530133 6:88312477-88312499 TGGGATGACCAGCTGCAGAGAGG - Intergenic
1012052248 6:94361191-94361213 CAGGATGACCAGCTGCAGACAGG - Intergenic
1012141847 6:95635336-95635358 CGGGTCAACCAGCAGCAGAGAGG + Intergenic
1012141976 6:95636206-95636228 TGGTACGACTAGCTGCAGAGAGG - Intergenic
1012538948 6:100337499-100337521 TGGGATCACCACCAACAGGGTGG - Intergenic
1013033287 6:106356943-106356965 TGGGGTGGCCAGTGGCAGAGTGG + Intergenic
1013086350 6:106861216-106861238 CAGGATGACTAGCTGCAGAGAGG - Intergenic
1013375554 6:109510298-109510320 CAGGATGACCAGCTGCAGAAAGG + Intronic
1013428401 6:110035037-110035059 TGGGGTGAGCATCTGCAGAGTGG + Intergenic
1013693099 6:112668209-112668231 TAGGATGACCAGTTGCAGATAGG + Intergenic
1013693130 6:112668350-112668372 TGGGATGACCAGTTACAGAGAGG + Intergenic
1014289307 6:119539897-119539919 TGGGATGACCAACTACAGAGAGG + Intergenic
1014391678 6:120872466-120872488 TGGGATGACCTGAAGCCTAGGGG + Intergenic
1015143326 6:129959007-129959029 TGGGAGGACCAGCTGCAGAGAGG + Intergenic
1015288527 6:131511290-131511312 TGGGCAGACAAGCAGAAGAGTGG + Intergenic
1015663734 6:135603817-135603839 TGAGGTGACCAGCTGCATAGAGG + Intergenic
1015663766 6:135604051-135604073 TGGGACGACCAGCTGCAGAGAGG + Intergenic
1016339647 6:143049371-143049393 TGGGAGGACCAGCAGCATAGAGG - Intergenic
1016502461 6:144736935-144736957 CAGGATGACCAGCAGCTGCGTGG - Intronic
1017171336 6:151458073-151458095 TGGGATGACCATTACCACAGAGG - Intronic
1017916569 6:158836151-158836173 TGGGAGGCTCAGCAGCAGGGGGG + Intergenic
1018064919 6:160118214-160118236 CAGGATGACCAGTTGCAGAGAGG - Intergenic
1018064942 6:160118381-160118403 TGGGACAACCAGCTGCAGAAAGG - Intergenic
1018186792 6:161272412-161272434 TGGGATGCCCATCAGAAGAATGG + Intronic
1018659933 6:166076640-166076662 GGGAATGACCAGCTGCAGAGAGG - Intergenic
1019296066 7:276131-276153 TGGAACAACCAGCTGCAGAGAGG - Intergenic
1019390984 7:786906-786928 TGGGGTGTCCAGGTGCAGAGAGG + Intergenic
1019910286 7:4096339-4096361 TGGTAAAACCAGCAGAAGAGAGG + Intronic
1020435854 7:8161616-8161638 TGGGCTGACCAGCTGGAGGGGGG + Intronic
1020649299 7:10855189-10855211 AGGGATGACCAGGGGCAGAGAGG + Intergenic
1020743066 7:12046592-12046614 TGGGATGATTAGCAACAGAGGGG + Intergenic
1020761265 7:12270052-12270074 GGAGATGACCAACTGCAGAGAGG + Intergenic
1020812415 7:12863848-12863870 CAGGATAACCAGCAGCATAGAGG - Intergenic
1020812425 7:12863918-12863940 TGGGACAACCAGCTGCAGAGAGG - Intergenic
1021021113 7:15599795-15599817 TGGAACGACCAGCTGCAGAGAGG - Intergenic
1021097281 7:16548083-16548105 CAGGACGACCAGCTGCAGAGAGG + Intronic
1021500746 7:21329872-21329894 TGGGATGACCAGCTGCAGAGAGG - Intergenic
1021561366 7:21971899-21971921 TGGGATGACCAGCTACAGAGAGG - Intergenic
1023789159 7:43737931-43737953 TGGGAGGACCAGCTGCAGAGAGG + Intergenic
1023790406 7:43749467-43749489 CGGGACTACCAGCTGCAGAGAGG - Intergenic
1024254830 7:47532501-47532523 TGGGACTTCCAGCTGCAGAGAGG + Intronic
1024656093 7:51452287-51452309 TGGGATGACCAGCAGGGGGCTGG + Intergenic
1024786189 7:52910877-52910899 TGAGATGACCAGCTGTGGAGAGG - Intergenic
1024799516 7:53059799-53059821 GGGGATCACCAGAAGCCGAGGGG - Intergenic
1025105029 7:56163490-56163512 TGGGATGACGATGAGCAGAATGG - Intergenic
1026359573 7:69591302-69591324 TGGGGTGACCAGTTGCAGACAGG - Intergenic
1027128375 7:75573194-75573216 TGGGACGACCAGCTACAGAGAGG + Intronic
1027128382 7:75573259-75573281 TAGGATAATCAGCTGCAGAGAGG + Intronic
1027219747 7:76206399-76206421 TGGGATGCCCAGGAGAACAGAGG + Intronic
1027333681 7:77126561-77126583 TGGGACAACCAGTAGTAGAGAGG - Intronic
1027779814 7:82507467-82507489 CAAGATGACCAGCAACAGAGAGG - Intergenic
1028233351 7:88330755-88330777 CAGGATGACCAGGTGCAGAGAGG + Intergenic
1028640807 7:93039994-93040016 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1029163693 7:98571044-98571066 TGAGATGCCCTGCATCAGAGCGG + Intergenic
1029327644 7:99823585-99823607 TTAGACAACCAGCAGCAGAGAGG + Intergenic
1029507830 7:100973141-100973163 AGGGCAGACCAGCATCAGAGAGG + Intronic
1029899336 7:104022619-104022641 CAGGATGACCAGCTGCAGGGAGG + Intergenic
1029973736 7:104814228-104814250 TGGGACAACCAGCTGCAGAGAGG - Intronic
1030514027 7:110519198-110519220 TCAGATGACCAGCTGCAGAGAGG - Intergenic
1031053790 7:116972131-116972153 AGGGAGGAGCAGCAGCAGGGTGG + Intronic
1031743685 7:125467950-125467972 TGGGAGGACCAGTAGCGGAGAGG - Intergenic
1031836498 7:126686113-126686135 TGGGATGACCAAATGCAGAGAGG + Intronic
1032658296 7:133955353-133955375 CGGGACAACCAGCTGCAGAGAGG - Intronic
1033293616 7:140110682-140110704 AGGGATGATAAGCAGTAGAGTGG - Intronic
1034153479 7:148935523-148935545 TGGGATGCCCAGCAACAGAAGGG + Intergenic
1034406393 7:150905702-150905724 CAGGACGACCAGCTGCAGAGAGG - Intergenic
1034410006 7:150935622-150935644 ACGAAGGACCAGCAGCAGAGTGG - Intergenic
1034481238 7:151321511-151321533 CAGGACGACCAGCTGCAGAGAGG + Intergenic
1034481251 7:151321581-151321603 TGGGATGACCAGCTGCAAAGAGG + Intergenic
1034481262 7:151321651-151321673 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1034533114 7:151708965-151708987 TGAGAATACCAGAAGCAGAGGGG + Intronic
1034762824 7:153689565-153689587 TGGTAAGGCAAGCAGCAGAGGGG - Intergenic
1034905416 7:154940437-154940459 TGGGCTGCACAGCAGCTGAGAGG + Intronic
1034917558 7:155053469-155053491 TGGGAGGAAAAGCAGCAGACTGG - Intergenic
1035252366 7:157605727-157605749 GGGGATGACCAGCTGCAGAGAGG - Intronic
1035434513 7:158849646-158849668 CAGGACGACCAGCTGCAGAGCGG - Intergenic
1035451018 7:158976754-158976776 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1036761951 8:11515367-11515389 GAGGATGACCAGGAGCTGAGAGG + Intronic
1036915418 8:12799574-12799596 TGGGACAACCAGCCGCAGAGAGG - Intergenic
1037003840 8:13752229-13752251 TGGGCTGCCCAGCAGCGAAGGGG - Intergenic
1037150273 8:15627206-15627228 TGGTAGGACCAGATGCAGAGAGG + Intronic
1037777863 8:21847650-21847672 CTGGAGGACCAGCTGCAGAGAGG - Intergenic
1038131434 8:24736356-24736378 TGGCAACACCAGCAGCAGAGAGG + Intergenic
1038776876 8:30539321-30539343 TGTCATCACCAGCAGCAGTGGGG + Intronic
1039182293 8:34880328-34880350 TGGGTTGACCAGCTGCAGAGAGG - Intergenic
1040661886 8:49583484-49583506 TGGGAGGACCAGCTACAGAGAGG + Intergenic
1040725612 8:50378780-50378802 CAGGATGACCAGCTGCAGAGAGG - Intronic
1040913056 8:52541011-52541033 TGGGATGACTGGGAACAGAGAGG + Intronic
1042165594 8:65942745-65942767 TGGGATAACCAGAAGCAGCCTGG + Intergenic
1042196795 8:66238008-66238030 CAGGATGACCAGCTGCAGAAAGG - Intergenic
1042196806 8:66238118-66238140 CCAGATGACCAGTAGCAGAGGGG - Intergenic
1042687834 8:71461924-71461946 TGGGACAACCAGCTGCAGAGAGG - Intronic
1043568073 8:81570591-81570613 CGGGACAACCAGCTGCAGAGAGG - Intergenic
1043745594 8:83869785-83869807 TGGGATGACCAGCTGCAGTGAGG + Intergenic
1043750298 8:83926263-83926285 CAGGAAGACCAGCTGCAGAGAGG - Intergenic
1043758323 8:84031848-84031870 TGGGACAATCAGCTGCAGAGAGG + Intergenic
1044008660 8:86965953-86965975 CAGGAGGACCAGCTGCAGAGAGG - Intronic
1044312458 8:90709335-90709357 GAGGATGAACAGAAGCAGAGTGG - Intronic
1044426906 8:92062629-92062651 TGGAATGAGTGGCAGCAGAGAGG + Intronic
1044524942 8:93241480-93241502 TGGGACAGCCAGCTGCAGAGAGG - Intergenic
1044622866 8:94207693-94207715 GGGGATGCCAAGCAGCAGATTGG - Intronic
1046395238 8:113632579-113632601 TGGGATGACCAGCTGCAGAGAGG - Intergenic
1046459705 8:114517982-114518004 GGGGATGACCGGTTGCAGAGAGG - Intergenic
1047352689 8:124090890-124090912 TGGAATAAGCAGCAGCCGAGTGG + Intronic
1047877011 8:129149811-129149833 TGAAAAGACCAGCAGGAGAGTGG + Intergenic
1048072693 8:131039416-131039438 GAGGATGACCTGCAGCAGCGAGG + Exonic
1048421670 8:134283884-134283906 TGGGATGATCAGCTTCAGAGAGG - Intergenic
1048639185 8:136333875-136333897 TGGGATGACCACATGCACAGTGG - Intergenic
1049021784 8:139961960-139961982 TGGGACAACCAGCTGCAGAGAGG + Intronic
1049824044 8:144655471-144655493 TGGGATGGCCAGCTGCAGAGAGG + Intergenic
1050130518 9:2407002-2407024 CAAGATGACCAACAGCAGAGAGG + Intergenic
1050182366 9:2934605-2934627 CTGGATGAACAGCTGCAGAGAGG + Intergenic
1050725522 9:8644141-8644163 TGGGATGACCAGCTGCAGAGAGG + Intronic
1051001777 9:12290838-12290860 AGAGATGATCAGCTGCAGAGAGG + Intergenic
1051789246 9:20781772-20781794 TGGCATCACTAGCAGCAGAGAGG - Exonic
1052633528 9:31071519-31071541 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1052707600 9:32011336-32011358 CGGGATGACCAGCTGCAGACAGG + Intergenic
1052715451 9:32110789-32110811 TGAGATGACAAGCAGTAGACTGG + Intergenic
1053076652 9:35139461-35139483 TGGGAGGACCTGCTGCAGTGAGG + Intergenic
1053128216 9:35599719-35599741 TGGGACAACCAGCTGCAGAGAGG + Intergenic
1056628825 9:88275958-88275980 AGCGATGCCTAGCAGCAGAGTGG - Intergenic
1056774394 9:89500186-89500208 GGAGGGGACCAGCAGCAGAGGGG + Intergenic
1056986137 9:91364782-91364804 TGGGACAACCAGCTGCAGAGAGG + Intergenic
1056986154 9:91364918-91364940 TAGGACAACCAGCTGCAGAGAGG + Intergenic
1057468583 9:95337892-95337914 TGGGACAACCAGCTGCAAAGAGG + Intergenic
1057468594 9:95337962-95337984 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1057510794 9:95678289-95678311 CAGGAGGACCAGCTGCAGAGAGG - Intergenic
1058091950 9:100814564-100814586 TGGGAAGACCAGCTGTAGAGAGG + Intergenic
1058510804 9:105713948-105713970 GGGGATGACCAGCTGCAGGGAGG + Intronic
1058510819 9:105714052-105714074 GGGGATGACCAGCTGCAGAGAGG + Intronic
1059566359 9:115386073-115386095 GGAGATGACCAGCTGCAGAGAGG + Intronic
1061820663 9:133225751-133225773 TGGGGTGTCCAGCAGGGGAGAGG - Intergenic
1062184745 9:135211903-135211925 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1062184765 9:135212037-135212059 CAGGACGACCAGCTGCAGAGAGG + Intergenic
1062238609 9:135524316-135524338 TGGGGTGTCCAGCAGGAGAGAGG + Intronic
1062270881 9:135707770-135707792 GGGGAAGGCCAGCAGCACAGTGG - Intronic
1185732688 X:2473993-2474015 TGGGATGGCGAGGTGCAGAGAGG + Intronic
1185733287 X:2478215-2478237 TGGGATGGCGAGGTGCAGAGAGG + Intronic
1186497666 X:10024758-10024780 TGGGATCACCAGCCCCACAGTGG + Intronic
1186805870 X:13139600-13139622 CAGGATGACCAGCTGCATAGAGG + Intergenic
1187261053 X:17685704-17685726 TGGGATCACCTGCTGCAGAAAGG + Intronic
1187774413 X:22739550-22739572 TGGGATGATCAAAAGCAAAGTGG + Intergenic
1187883318 X:23865756-23865778 TGAGGTGAGCAGCATCAGAGGGG - Intronic
1188643635 X:32537262-32537284 AGGGATGAACATCAGGAGAGAGG + Intronic
1188756539 X:33969561-33969583 TGGGACAACCAGCTGCAGAGAGG + Intergenic
1189083608 X:37997940-37997962 TGGGACCACCAGCTGCAGAGAGG + Intronic
1189590743 X:42507902-42507924 TTGGCAGACCTGCAGCAGAGGGG + Intergenic
1189856323 X:45228829-45228851 TGGGGTGACAAGCTGTAGAGAGG - Intergenic
1189856332 X:45228885-45228907 TGGGGCAACCAGCTGCAGAGAGG - Intergenic
1190369533 X:49727496-49727518 CAGGATGACCAGCTGCAAAGAGG + Intergenic
1190444835 X:50514461-50514483 TGGGACAACCAGCTGCAGAGAGG - Intergenic
1190444843 X:50514513-50514535 TGGGATGACCAGATGCAGAGAGG - Intergenic
1190681771 X:52831837-52831859 TGGGACGACCAGCTGCAGAGAGG + Intergenic
1190998859 X:55637836-55637858 TGGGACAACCAGCTGCAGAGAGG + Intergenic
1191221273 X:57990296-57990318 TGGAATGATCAGCTGCAGAGAGG + Intergenic
1192265307 X:69533651-69533673 CAGGATGACCAGCTGCAGTGAGG - Intergenic
1193108437 X:77704307-77704329 CAGGATGACCAGCTGCAGAGAGG - Intronic
1193467612 X:81867960-81867982 TAGGATGATCAGCAGCAGAGAGG - Intergenic
1193467632 X:81868141-81868163 TGGGATGACCAGCTGCAGAGAGG - Intergenic
1193468717 X:81875277-81875299 CCAGATGACCAGCTGCAGAGAGG - Intergenic
1193554176 X:82932789-82932811 TGGGATGACCAGCTGTGGAGAGG + Intergenic
1193554197 X:82932929-82932951 TGGGGTGACCAGCTGTGGAGAGG + Intergenic
1193919338 X:87406721-87406743 TGAGAGGACCAGCTGCAGAGAGG - Intergenic
1194379381 X:93175293-93175315 TGGGACCACCAGCTACAGAGAGG + Intergenic
1194379399 X:93175464-93175486 TGGGATGACCAGTTGCAGCAAGG + Intergenic
1194380317 X:93182003-93182025 TGGGACCACCAGCTACAGAGAGG + Intergenic
1194853733 X:98902414-98902436 TGGGATGACTGGAAGCAGGGAGG + Intergenic
1195126531 X:101814008-101814030 CAGGATGACGAGCTGCAGAGAGG + Intergenic
1195126550 X:101814149-101814171 TGGGACAACCAGCTGCAGAGAGG + Intergenic
1195178502 X:102333936-102333958 TGGGATGACCAGCTGCAGAGAGG - Intergenic
1195178527 X:102334101-102334123 TGGGACGACCAGCTGCGGAGAGG - Intergenic
1195180337 X:102352982-102353004 TGGGACGACCAGCTGCGGAGAGG + Intergenic
1195180362 X:102353147-102353169 TGGGATGACCAGCTGCAGAGAGG + Intergenic
1195432694 X:104807045-104807067 TGGTATGAATAGCAGCAGATAGG + Intronic
1197421304 X:126238672-126238694 TAGAATGACCAGCTGCAGAGAGG + Intergenic
1197609509 X:128623021-128623043 TGGGATGGCCAGCTGTGGAGAGG - Intergenic
1197795959 X:130299228-130299250 TGGAATGACCAGTGGCAGAGAGG - Intergenic
1198699439 X:139381995-139382017 GGGGATGACCAGCTACAGAGAGG - Intergenic
1198699450 X:139382068-139382090 GGGGATGACCAGCTGTAGAGAGG - Intergenic
1198768699 X:140105529-140105551 TGAGATGACCAGAGGCAGAAAGG - Intergenic
1199360001 X:146907027-146907049 CAGGATGACCAGCAGCAGAGAGG - Intergenic
1199861081 X:151801074-151801096 GAGGATGACCAGCTGCAGAGAGG - Intergenic
1201133315 Y:10971731-10971753 TGGAATGAACAGCAGTAGAGAGG - Intergenic
1201796922 Y:17905951-17905973 TGGGATGACCAGCTAGAGTGAGG + Intergenic
1201804631 Y:18000034-18000056 TGGGATGACCAGCTAGAGTGAGG - Intergenic
1202358297 Y:24075010-24075032 TGGGATGACCAGCTAGAGTGAGG + Intergenic
1202512481 Y:25595103-25595125 TGGGATGACCAGCTAGAGTGAGG - Intergenic