ID: 964255123

View in Genome Browser
Species Human (GRCh38)
Location 3:154766843-154766865
Sequence GGCCTCCTGATCCAGGGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964255123_964255134 20 Left 964255123 3:154766843-154766865 CCTGCACCCTGGATCAGGAGGCC No data
Right 964255134 3:154766886-154766908 GGGTGGCTGCAGCTGCACCTGGG 0: 15
1: 61
2: 203
3: 337
4: 751
964255123_964255136 22 Left 964255123 3:154766843-154766865 CCTGCACCCTGGATCAGGAGGCC No data
Right 964255136 3:154766888-154766910 GTGGCTGCAGCTGCACCTGGGGG No data
964255123_964255128 -1 Left 964255123 3:154766843-154766865 CCTGCACCCTGGATCAGGAGGCC No data
Right 964255128 3:154766865-154766887 CTGGATCCACAGCCATGACTTGG No data
964255123_964255138 24 Left 964255123 3:154766843-154766865 CCTGCACCCTGGATCAGGAGGCC No data
Right 964255138 3:154766890-154766912 GGCTGCAGCTGCACCTGGGGGGG No data
964255123_964255130 3 Left 964255123 3:154766843-154766865 CCTGCACCCTGGATCAGGAGGCC No data
Right 964255130 3:154766869-154766891 ATCCACAGCCATGACTTGGGTGG No data
964255123_964255129 0 Left 964255123 3:154766843-154766865 CCTGCACCCTGGATCAGGAGGCC No data
Right 964255129 3:154766866-154766888 TGGATCCACAGCCATGACTTGGG No data
964255123_964255133 19 Left 964255123 3:154766843-154766865 CCTGCACCCTGGATCAGGAGGCC No data
Right 964255133 3:154766885-154766907 TGGGTGGCTGCAGCTGCACCTGG 0: 18
1: 58
2: 127
3: 341
4: 774
964255123_964255137 23 Left 964255123 3:154766843-154766865 CCTGCACCCTGGATCAGGAGGCC No data
Right 964255137 3:154766889-154766911 TGGCTGCAGCTGCACCTGGGGGG No data
964255123_964255135 21 Left 964255123 3:154766843-154766865 CCTGCACCCTGGATCAGGAGGCC No data
Right 964255135 3:154766887-154766909 GGTGGCTGCAGCTGCACCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964255123 Original CRISPR GGCCTCCTGATCCAGGGTGC AGG (reversed) Intergenic
No off target data available for this crispr