ID: 964257334

View in Genome Browser
Species Human (GRCh38)
Location 3:154791112-154791134
Sequence CAGGATTTCCATGGATATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964257334_964257338 0 Left 964257334 3:154791112-154791134 CCTCTATATCCATGGAAATCCTG No data
Right 964257338 3:154791135-154791157 CCATGACCATCATGTCCATATGG No data
964257334_964257339 1 Left 964257334 3:154791112-154791134 CCTCTATATCCATGGAAATCCTG No data
Right 964257339 3:154791136-154791158 CATGACCATCATGTCCATATGGG No data
964257334_964257340 2 Left 964257334 3:154791112-154791134 CCTCTATATCCATGGAAATCCTG No data
Right 964257340 3:154791137-154791159 ATGACCATCATGTCCATATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964257334 Original CRISPR CAGGATTTCCATGGATATAG AGG (reversed) Intergenic
No off target data available for this crispr