ID: 964259037

View in Genome Browser
Species Human (GRCh38)
Location 3:154812391-154812413
Sequence AGGGAGAGCACAGTGATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964259037_964259046 23 Left 964259037 3:154812391-154812413 CCCACAATCACTGTGCTCTCCCT No data
Right 964259046 3:154812437-154812459 CCAAGCCATGTGGCTGCTGGTGG No data
964259037_964259049 30 Left 964259037 3:154812391-154812413 CCCACAATCACTGTGCTCTCCCT No data
Right 964259049 3:154812444-154812466 ATGTGGCTGCTGGTGGTGGTTGG No data
964259037_964259043 13 Left 964259037 3:154812391-154812413 CCCACAATCACTGTGCTCTCCCT No data
Right 964259043 3:154812427-154812449 AGATTCTCTTCCAAGCCATGTGG No data
964259037_964259047 26 Left 964259037 3:154812391-154812413 CCCACAATCACTGTGCTCTCCCT No data
Right 964259047 3:154812440-154812462 AGCCATGTGGCTGCTGGTGGTGG No data
964259037_964259044 20 Left 964259037 3:154812391-154812413 CCCACAATCACTGTGCTCTCCCT No data
Right 964259044 3:154812434-154812456 CTTCCAAGCCATGTGGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964259037 Original CRISPR AGGGAGAGCACAGTGATTGT GGG (reversed) Intergenic