ID: 964261014

View in Genome Browser
Species Human (GRCh38)
Location 3:154836889-154836911
Sequence CAGTAGAATTACTTGAATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964261014_964261018 0 Left 964261014 3:154836889-154836911 CCTGAATTCAAGTAATTCTACTG No data
Right 964261018 3:154836912-154836934 CCTCAGCCTCCTGAGGAGCTGGG 0: 893
1: 102567
2: 209178
3: 250334
4: 261160
964261014_964261016 -1 Left 964261014 3:154836889-154836911 CCTGAATTCAAGTAATTCTACTG No data
Right 964261016 3:154836911-154836933 GCCTCAGCCTCCTGAGGAGCTGG 0: 677
1: 89751
2: 196903
3: 238024
4: 228169
964261014_964261020 8 Left 964261014 3:154836889-154836911 CCTGAATTCAAGTAATTCTACTG No data
Right 964261020 3:154836920-154836942 TCCTGAGGAGCTGGGATTACAGG 0: 427
1: 56530
2: 147576
3: 253096
4: 520653
964261014_964261015 -7 Left 964261014 3:154836889-154836911 CCTGAATTCAAGTAATTCTACTG No data
Right 964261015 3:154836905-154836927 TCTACTGCCTCAGCCTCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964261014 Original CRISPR CAGTAGAATTACTTGAATTC AGG (reversed) Intergenic
No off target data available for this crispr