ID: 964261786

View in Genome Browser
Species Human (GRCh38)
Location 3:154847823-154847845
Sequence CCTTGTCCAGGCCATTTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964261786_964261790 7 Left 964261786 3:154847823-154847845 CCTTTAAAATGGCCTGGACAAGG No data
Right 964261790 3:154847853-154847875 AGCTAGAGCACATCAAAGGTAGG No data
964261786_964261789 3 Left 964261786 3:154847823-154847845 CCTTTAAAATGGCCTGGACAAGG No data
Right 964261789 3:154847849-154847871 AAATAGCTAGAGCACATCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964261786 Original CRISPR CCTTGTCCAGGCCATTTTAA AGG (reversed) Intergenic
No off target data available for this crispr