ID: 964265736

View in Genome Browser
Species Human (GRCh38)
Location 3:154893484-154893506
Sequence CTGTCTTATTAGAGGGCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964265736_964265740 -3 Left 964265736 3:154893484-154893506 CCACCTGCCCTCTAATAAGACAG No data
Right 964265740 3:154893504-154893526 CAGCAATTCTTCAGCTCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964265736 Original CRISPR CTGTCTTATTAGAGGGCAGG TGG (reversed) Intergenic
No off target data available for this crispr