ID: 964270291

View in Genome Browser
Species Human (GRCh38)
Location 3:154948137-154948159
Sequence CATTGAAACCAGTGTGTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964270287_964270291 19 Left 964270287 3:154948095-154948117 CCAATGAGAACAAAGACACAACA 0: 2553
1: 4771
2: 3165
3: 1505
4: 1050
Right 964270291 3:154948137-154948159 CATTGAAACCAGTGTGTAGAGGG No data
964270289_964270291 -6 Left 964270289 3:154948120-154948142 CCAGAATCTCTAGGACACATTGA No data
Right 964270291 3:154948137-154948159 CATTGAAACCAGTGTGTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964270291 Original CRISPR CATTGAAACCAGTGTGTAGA GGG Intergenic
No off target data available for this crispr