ID: 964270291 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:154948137-154948159 |
| Sequence | CATTGAAACCAGTGTGTAGA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 964270287_964270291 | 19 | Left | 964270287 | 3:154948095-154948117 | CCAATGAGAACAAAGACACAACA | 0: 2553 1: 4771 2: 3165 3: 1505 4: 1050 |
||
| Right | 964270291 | 3:154948137-154948159 | CATTGAAACCAGTGTGTAGAGGG | No data | ||||
| 964270289_964270291 | -6 | Left | 964270289 | 3:154948120-154948142 | CCAGAATCTCTAGGACACATTGA | No data | ||
| Right | 964270291 | 3:154948137-154948159 | CATTGAAACCAGTGTGTAGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 964270291 | Original CRISPR | CATTGAAACCAGTGTGTAGA GGG | Intergenic | ||
| No off target data available for this crispr | |||||