ID: 964278410

View in Genome Browser
Species Human (GRCh38)
Location 3:155034103-155034125
Sequence TACTGTTAAGTTGAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 189}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964278410 Original CRISPR TACTGTTAAGTTGAGGAGGA AGG (reversed) Intronic
906071759 1:43021863-43021885 TATTTTTAAGCTGAGGTGGAAGG + Intergenic
909621017 1:77667407-77667429 TACTTTTAAGTGTAGGAGAAGGG - Intronic
909669303 1:78169729-78169751 TACTATTAAATTGAGAAAGAAGG - Intergenic
909757341 1:79243035-79243057 TACCATTAAGCTGAGCAGGATGG + Intergenic
911326465 1:96474744-96474766 AACTCTTAACTTGAGGAAGATGG + Intergenic
911429913 1:97772709-97772731 AACTGGTAAGTAGAGGAGAATGG + Intronic
912077090 1:105888573-105888595 TGCTTGTAAGTTGAGGAGCAAGG - Intergenic
914000450 1:143690308-143690330 TACTGTCAAGGTCAGGAGGCGGG - Intergenic
916812599 1:168318482-168318504 TTCTGTTAACTTGAGCAGGTGGG + Intergenic
918485243 1:185022046-185022068 TAGTGGTAAGTTGTGGGGGAAGG - Intergenic
919253387 1:195089599-195089621 TTCTGTAATGTTGAGGAAGAGGG - Intergenic
919565557 1:199181021-199181043 AACTGTTATGTTGACCAGGAAGG + Intergenic
920460492 1:206135827-206135849 TAATGTTAAATTGAGGTGGTGGG - Intergenic
920613621 1:207467241-207467263 TACTGTTAAAATGAGAAGAACGG + Intronic
921791368 1:219294340-219294362 GAATGGAAAGTTGAGGAGGAGGG - Intergenic
922955787 1:229598520-229598542 TACTGCTGAGTTAAGGAGGCGGG + Intronic
1063791422 10:9452832-9452854 TACTGTTAAGAAGTGGAGGGAGG - Intergenic
1065564015 10:26991087-26991109 TGTTGTTTAGTTGAGGGGGAGGG - Intergenic
1067560640 10:47302021-47302043 GTCTGCTAAGTGGAGGAGGAGGG - Intronic
1068443111 10:57085180-57085202 TACTGATAAGTTCAGAAGAAAGG + Intergenic
1069236304 10:66079216-66079238 TACTGTAAAGTAGAGTTGGATGG + Intronic
1069363459 10:67671269-67671291 TACTGCAAAGCTGAAGAGGAAGG + Intronic
1071810689 10:89177694-89177716 TACTGATAGTTTGAGAAGGAAGG - Intergenic
1073980332 10:109146735-109146757 GACTGTTGGGGTGAGGAGGAAGG + Intergenic
1075085709 10:119413084-119413106 TACTGCAGAGATGAGGAGGAGGG + Intronic
1079033192 11:17000965-17000987 TAGTGCTGAGTTGAGGAGTAGGG - Intronic
1081704684 11:45174794-45174816 TAGTGGTTAGTTCAGGAGGAGGG - Intronic
1088542114 11:110923900-110923922 CACTGTTAAATTGGGAAGGAAGG + Intergenic
1090280388 11:125451437-125451459 TTCTGTTCAGCTGAGGAGGATGG - Intronic
1092576664 12:9791294-9791316 TACTGTGAAGCTGAGGAATACGG + Intergenic
1093491027 12:19704361-19704383 TTCTGAAAAATTGAGGAGGAGGG + Intronic
1094401712 12:30068996-30069018 TGGTGGTAAGGTGAGGAGGAGGG - Intergenic
1095095947 12:38149351-38149373 TTCTGTGAACTTGGGGAGGAGGG + Intergenic
1095622411 12:44273422-44273444 TTCTGATAAATAGAGGAGGAAGG + Intronic
1097595114 12:61620115-61620137 TTCTTTTAAGTAGAGGAGGCAGG - Intergenic
1097694198 12:62761287-62761309 TACTCTGTATTTGAGGAGGAAGG + Intronic
1099097503 12:78393059-78393081 TACTGTTGAGCTGAGATGGAGGG - Intergenic
1101434522 12:104653728-104653750 TAATGTTAAGTTGATGGAGAAGG - Intronic
1102046932 12:109835237-109835259 TATTTTCAAGCTGAGGAGGAAGG - Intergenic
1102689599 12:114750086-114750108 TACTTGGAAGTTGAGGTGGAAGG + Intergenic
1102750782 12:115292127-115292149 TTCTGTTAAGTTGAGGAAGAAGG - Intergenic
1102764981 12:115424661-115424683 TACTTTTAAGATGAGATGGACGG - Intergenic
1104157207 12:126144906-126144928 TAATGTTATGCTGAGGAAGAAGG + Intergenic
1105303750 13:19155478-19155500 CACTGCTAGGTGGAGGAGGAGGG + Intergenic
1107576052 13:41723798-41723820 GAGTGTGAAGTTCAGGAGGAAGG + Intronic
1108974270 13:56418399-56418421 TACTGTAGAGTGGAGGAGGCTGG - Intergenic
1110498263 13:76194541-76194563 TACTATAAAATTGAAGAGGAAGG - Intergenic
1112039002 13:95526980-95527002 TTCTGTTCAGGTGAGGAGGGAGG + Intronic
1114132183 14:19803738-19803760 TTCTGAAAATTTGAGGAGGAAGG - Intronic
1114506837 14:23222588-23222610 TTCTGAAAAGTAGAGGAGGAGGG + Intronic
1114856195 14:26447576-26447598 TACTGTTAGGTTGAGTATGGTGG - Exonic
1115395684 14:32906070-32906092 TTCAGTTAAGTAGAGGAGAAAGG - Intergenic
1115783822 14:36801613-36801635 TACTGTTATTTTCAGCAGGAGGG + Intronic
1118329657 14:64805489-64805511 TAGTGTTAAGTGAAGGAGGTGGG - Intronic
1118349240 14:64961599-64961621 GACTGTTAAGATGATGAGGCTGG - Intronic
1120778853 14:88467408-88467430 TAATGTAAAGTTGAGGATGAAGG - Exonic
1122455289 14:101845593-101845615 TACTGTTAATTTCATGAGAAAGG + Intronic
1123575268 15:21659485-21659507 TTCTGAAAATTTGAGGAGGAAGG - Intergenic
1123611886 15:22101955-22101977 TTCTGAAAATTTGAGGAGGAAGG - Intergenic
1124714052 15:32042137-32042159 TAGTGTTAAGGTGTGGAGGGAGG + Intronic
1125830513 15:42713466-42713488 TACTCCTGATTTGAGGAGGAAGG + Intronic
1126182936 15:45803807-45803829 TACTTTTGGCTTGAGGAGGAAGG + Intergenic
1129573402 15:76715084-76715106 TTCTGTTCAGTTTAAGAGGAGGG - Intronic
1130751114 15:86714212-86714234 TGCCGTTAAGTTGCAGAGGATGG + Intronic
1131387268 15:92017991-92018013 TGCTGATGAGTGGAGGAGGATGG + Intronic
1132014513 15:98303845-98303867 TACTGTTATTTTTAGGAGGAGGG - Intergenic
1202984136 15_KI270727v1_random:393729-393751 TTCTGAAAATTTGAGGAGGAAGG - Intergenic
1134241722 16:12511772-12511794 TACTCTAAAGTTGCGGGGGAGGG - Intronic
1134803593 16:17106915-17106937 TACTCTGAGGATGAGGAGGATGG + Exonic
1137740899 16:50772461-50772483 TATTGTTAAGTTAAAAAGGAAGG - Intronic
1138120247 16:54395516-54395538 TACAGTTACGTTGAGGATTATGG + Intergenic
1138801259 16:60033061-60033083 CACTGTAAAGGAGAGGAGGAGGG - Intergenic
1139031582 16:62888659-62888681 GACTGAGAAGGTGAGGAGGAAGG - Intergenic
1140377542 16:74456811-74456833 TTCTGTAAAGATGAGGAAGAGGG + Intronic
1140834318 16:78779388-78779410 TAATGTCAAGCTGAGGTGGAAGG - Intronic
1142546127 17:704376-704398 TAGTGTTACTGTGAGGAGGAGGG - Intronic
1145415733 17:22712289-22712311 GATAGTTAAGTTGAGGATGATGG + Intergenic
1145415739 17:22712343-22712365 GATAGTTAAGTTGAGGATGATGG + Intergenic
1146501190 17:33365920-33365942 AACTGTCCAGTTGAGCAGGAAGG + Intronic
1149114247 17:53072803-53072825 TACTCTTAGGTTGAGCATGAAGG - Intergenic
1155288987 18:24321842-24321864 TATTGCTAAGTTCTGGAGGAGGG + Intronic
1155618732 18:27751264-27751286 TACTGTTAGGTTGAAGAAGATGG + Intergenic
1156681824 18:39599239-39599261 AACTGTTCAGTAGAGGAGTAGGG + Intergenic
1157034867 18:43959418-43959440 TATTGGTAAGTTGAGAAGAATGG - Intergenic
1158794908 18:60833244-60833266 TACTGTGCAGTGGAGGAAGAAGG + Intergenic
1159863151 18:73672982-73673004 TAATGTCAAGTGGAGGAGGACGG - Intergenic
1160033406 18:75281354-75281376 TGCTGTTGTTTTGAGGAGGAGGG + Intronic
1161612992 19:5253929-5253951 TACTGTTCAGATGAGGAAGTGGG + Intronic
1161758901 19:6156282-6156304 CATTGTTAAGTTGGGGAGGAAGG + Intronic
1161966728 19:7553097-7553119 TATTGTTAGATTGGGGAGGAAGG + Intronic
1162040950 19:7970860-7970882 TAGTGTTAAATAGATGAGGATGG - Intronic
1168463461 19:56582227-56582249 TAATGATAATTTAAGGAGGATGG + Exonic
927405913 2:22766677-22766699 TACTTTTAAAGTGAGGAGAAAGG + Intergenic
930276207 2:49314093-49314115 TTCTGTTAATTTGGGGTGGAGGG - Intergenic
933334126 2:80934464-80934486 TACTGCTAAATTGAGGAACAGGG + Intergenic
935491605 2:103727779-103727801 TTTTGAAAAGTTGAGGAGGAGGG - Intergenic
937704149 2:124898856-124898878 TACTGTTAGGAGGAGGAGGCCGG - Intronic
938859312 2:135350654-135350676 TACTGGTATTTTGAGCAGGAGGG - Intronic
941080746 2:161057889-161057911 TGCTGTGAAGTAGAGGAGGAGGG + Intergenic
941366425 2:164617143-164617165 TACCCCAAAGTTGAGGAGGAGGG - Intronic
942567751 2:177283341-177283363 TATAGTTAAGTTGAAGAAGACGG - Intronic
943201661 2:184835064-184835086 TCCTGTTAATTTGCTGAGGAAGG - Intronic
943253721 2:185566058-185566080 TGCTGTTAGGATGAGGAGAAAGG + Intergenic
943828237 2:192424503-192424525 TATTGTGAAGTGGTGGAGGAAGG - Intergenic
943900443 2:193427304-193427326 TGCTGTTAGGTTGAGGAGCTAGG - Intergenic
947256996 2:228177479-228177501 TACTCTTAAGTTGAGGAACAGGG - Intronic
947461743 2:230309729-230309751 TGCAGTGAAGTTCAGGAGGAAGG - Intronic
947470821 2:230399932-230399954 TGCAGTGAAGTTCAGGAGGAAGG - Intronic
947606858 2:231491766-231491788 TACTGTTGAGTGGGGGAGGGAGG + Intergenic
1170255857 20:14342225-14342247 TACTCTTAGGTTGAGAAGGAAGG + Intronic
1173570175 20:44070895-44070917 TACTGCTCAGTTGTGGAGGCTGG + Intergenic
1177783886 21:25648992-25649014 CACTGTTAAAAAGAGGAGGAGGG - Intronic
949408659 3:3740946-3740968 TGCTTTTAATCTGAGGAGGAAGG + Intronic
949627184 3:5880083-5880105 TACTGGGAAGTTGAGGAAGAAGG + Intergenic
950410746 3:12835055-12835077 TTCTGCTAAGTTGACCAGGATGG + Exonic
950813167 3:15670253-15670275 TACTGAGAGGCTGAGGAGGAGGG - Exonic
952355761 3:32582385-32582407 TAATGTTAAATTGAGGAACATGG + Intergenic
952533642 3:34288189-34288211 TATTGTGAGGTAGAGGAGGAGGG - Intergenic
953424622 3:42783679-42783701 AACTGGTTAGTAGAGGAGGAGGG + Intronic
953482447 3:43262999-43263021 TGGTGTGAAGTTGAGGAGGATGG - Intergenic
955755315 3:62219849-62219871 TACAGTTTAGTGGAGGAGGCAGG + Intronic
956409747 3:68967245-68967267 TGCTGTTTAGTGGAGGGGGAGGG - Intergenic
957800920 3:85079895-85079917 GACTGTGAACTTGAGAAGGAAGG + Intronic
958918007 3:100071394-100071416 TACAGTTAAGATGGGGAGGCTGG - Intronic
959127831 3:102311964-102311986 TTCTGAAAAATTGAGGAGGAGGG + Intronic
960079465 3:113525832-113525854 TTTTGGTAAGTTCAGGAGGATGG + Intergenic
962384688 3:134923326-134923348 TCATGTTAAGCTGTGGAGGAAGG + Intronic
963082337 3:141405883-141405905 TTTTGGTAATTTGAGGAGGAAGG + Intronic
964278410 3:155034103-155034125 TACTGTTAAGTTGAGGAGGAAGG - Intronic
964464950 3:156981650-156981672 TAGGATTAAGTTGAGGAGTATGG + Intronic
964956423 3:162363457-162363479 TACTGTGAAATTGAGCAGAAAGG - Intergenic
964993095 3:162839556-162839578 TACTTTGAAGTAGAAGAGGAGGG - Intergenic
965520950 3:169667863-169667885 TACATTTGAGTTGAGGAGGGGGG + Intergenic
966261690 3:177985747-177985769 TACAGTGAAGTAGAGGAGAATGG - Intergenic
967092587 3:186147948-186147970 CACTGTTAGGTTGAGCAGAATGG + Exonic
969284751 4:6196169-6196191 TACTGGAAAGTAGAGGAGAAAGG - Intronic
969979682 4:11141814-11141836 TATTGTGAAGTTCAGGAAGAGGG - Intergenic
971179248 4:24312781-24312803 TACTGTTATGTTGTGGAACAAGG - Intergenic
973565069 4:52177608-52177630 TACTGTGAAGTTGGGGATGGGGG - Intergenic
975694037 4:76994061-76994083 TTCTGTTAATTTCAGGGGGAGGG - Intronic
977177614 4:93835674-93835696 TACTGTTAGGTTGATGAAGAAGG + Intergenic
978843889 4:113248851-113248873 TACTGGTGATTTGAGGTGGAAGG - Intronic
981666789 4:147237027-147237049 TATTGTTCAGTGGTGGAGGAGGG - Intergenic
982388354 4:154837133-154837155 AACTGTTAACTTGGGGAAGAGGG - Intergenic
982568882 4:157023311-157023333 TTTTGTTAAATTGAGGAAGAGGG + Intergenic
982611557 4:157580619-157580641 TATAGAAAAGTTGAGGAGGATGG + Intergenic
983165354 4:164469982-164470004 AACTGTTAAGTTCACCAGGAGGG + Intergenic
984110202 4:175603494-175603516 TTCTGTTGATTTGAGGTGGAGGG + Intergenic
985128712 4:186720885-186720907 TTCTGTTAATTTGAGAAGGATGG - Intronic
986458651 5:7945932-7945954 TGCTGAGAGGTTGAGGAGGAAGG - Intergenic
988141689 5:27250786-27250808 TAATGTTAAGTTGAGTAAAAGGG + Intergenic
988633682 5:32958310-32958332 TACAGTTAAACTGAGGAGGCTGG - Intergenic
993939166 5:94038390-94038412 TACTGTTAGCTTAAGGAGGTGGG - Intronic
1000234510 5:159344914-159344936 TACTGATAAGGACAGGAGGAAGG - Intergenic
1007079827 6:39092066-39092088 TCCTGTTAAGTGGAAGGGGAAGG - Intergenic
1010334897 6:74669070-74669092 CATTGTTAAGTTGTGGAGTATGG - Intergenic
1010618028 6:78037657-78037679 TTCTGTTAAGTTCAGGACTATGG + Intergenic
1012702445 6:102477546-102477568 TTCTGAAAAGTCGAGGAGGAGGG + Intergenic
1014350999 6:120345354-120345376 GACTGTTAAGTTCAAGAGCAGGG - Intergenic
1014487558 6:122018401-122018423 TACAGATAAGTTGAGGATTAGGG + Intergenic
1015119248 6:129683378-129683400 TTCTTTTAATTTGAGGTGGAAGG + Intronic
1016119594 6:140329907-140329929 AGTTGTTAAGTTGAGGAGCAAGG + Intergenic
1016453318 6:144206261-144206283 TTCTGAAAAATTGAGGAGGAAGG - Intergenic
1016568241 6:145483190-145483212 TACTTTTAACTTTAGGAGGTAGG - Intergenic
1021633437 7:22668211-22668233 ACCTGTTAAGTGGAGGTGGAGGG + Intergenic
1022605438 7:31809370-31809392 TACTGTTAAGCTGTGGAGTGAGG + Intronic
1024688913 7:51778591-51778613 TTATGTTCAGTTTAGGAGGAAGG - Intergenic
1026159016 7:67852618-67852640 GAGGGATAAGTTGAGGAGGATGG + Intergenic
1027199208 7:76052324-76052346 TACAGCTAAGGTGGGGAGGATGG + Intronic
1027629257 7:80581744-80581766 TACAGTTATTTTGAGGAGAATGG + Intronic
1028086004 7:86638679-86638701 GACTGTAAACTTCAGGAGGAGGG - Intergenic
1030029930 7:105359496-105359518 TACTGTGAAGTTGATAAGCATGG - Intronic
1030431124 7:109450584-109450606 TTCTGTAAAATAGAGGAGGAGGG - Intergenic
1032518059 7:132521691-132521713 TTTTGTGAAGTTGGGGAGGAAGG - Intronic
1033881554 7:145890319-145890341 TACAGATAAGTTCAGTAGGAGGG - Intergenic
1038002604 8:23404141-23404163 TACTTTTAACTAGAGGAGGATGG + Exonic
1038873942 8:31527483-31527505 TGCTGTTAAGAAGAAGAGGAAGG - Intergenic
1041139258 8:54797655-54797677 TATTGTCAAGTTGTGGAAGAAGG - Intergenic
1043069438 8:75620388-75620410 TACAGTCAGGTTGTGGAGGAGGG - Intergenic
1045113695 8:98958593-98958615 TATTGTTAAGTGGGGGTGGAGGG - Intergenic
1045140623 8:99278199-99278221 TACTCTCAAATTGAGGGGGATGG + Intronic
1051211637 9:14751167-14751189 TACTTTTAAGTGGAGAAAGAAGG + Intronic
1051571224 9:18561500-18561522 TACTGTTGATTTGGGGTGGACGG + Intronic
1056451460 9:86721330-86721352 TACCATTAATTTGAGGAGCAAGG + Intergenic
1056574578 9:87845321-87845343 TTCTGGTATGTTGAGGAGAACGG + Intergenic
1056996885 9:91470992-91471014 TACTGTTGATTTGGGGTGGAGGG + Intergenic
1058244619 9:102607359-102607381 TACTGGCAAGCTGAGGAGCAAGG + Intergenic
1062659380 9:137620700-137620722 TCCTGTTTAGCTGAGGAGGAAGG + Intronic
1185989071 X:4872792-4872814 TACTCTTAAGTTAAAGAGCATGG - Intergenic
1187608192 X:20909955-20909977 CAAAGTTAAGTTGAGAAGGAAGG + Intergenic
1189119211 X:38376053-38376075 TACTGCTAAGTGAAGGAAGAGGG + Intronic
1189881173 X:45494198-45494220 TACTGAAAAATAGAGGAGGAGGG - Intergenic
1194071899 X:89335338-89335360 TACAGTTGAATTGTGGAGGAGGG - Intergenic
1194281665 X:91961379-91961401 TTCTGTTAAGATCAGGAGCAAGG + Intronic
1196803561 X:119564674-119564696 TACGGTTAAGATGATGAGGTGGG + Intronic
1198737912 X:139807752-139807774 TTCTGTTAAGTTGCCGAGGCTGG - Intronic
1199447055 X:147937564-147937586 TACTGTTAGGTTGAGAAAAATGG - Exonic
1199564669 X:149202618-149202640 TAATGTAAAGTGGAGGGGGAAGG - Intergenic
1200276755 X:154740735-154740757 TCCTGTTATGGTGAAGAGGAAGG - Intronic
1200408994 Y:2843226-2843248 TATTGTTAAGTGGATGAGCAAGG + Intronic
1200599258 Y:5186034-5186056 TTCTGTTAAGATCAGGAGCAAGG + Intronic
1200726143 Y:6671067-6671089 TACAGTTGAATTGTGGAGGAGGG - Intergenic
1201154016 Y:11113454-11113476 TATTGTGAAGTTGAGGTGGGAGG - Intergenic
1201765388 Y:17569650-17569672 TTCTGTGAAGTTGGGGAGGAGGG - Intergenic
1201772963 Y:17635422-17635444 TAATATTAAGTTGAGGCAGATGG - Intergenic
1201828592 Y:18270564-18270586 TAATATTAAGTTGAGGCAGATGG + Intergenic
1201836164 Y:18336339-18336361 TTCTGTGAAGTTGGGGAGGAGGG + Intergenic
1202048632 Y:20758686-20758708 TATTGTTAAGTGGATGAGCAAGG + Intronic