ID: 964281338

View in Genome Browser
Species Human (GRCh38)
Location 3:155069808-155069830
Sequence TAGGATATTAAAATAGCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 244}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964281338_964281342 25 Left 964281338 3:155069808-155069830 CCTTCAGCTATTTTAATATCCTA 0: 1
1: 0
2: 1
3: 16
4: 244
Right 964281342 3:155069856-155069878 TGCCCTTGTCCATGTGATGTTGG 0: 1
1: 1
2: 1
3: 11
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964281338 Original CRISPR TAGGATATTAAAATAGCTGA AGG (reversed) Intronic
902041836 1:13498321-13498343 TTGGATATTATAAAATCTGAAGG + Intronic
903951015 1:26995986-26996008 TAGGACTTTAAATTAGCTCATGG - Intronic
905422191 1:37855203-37855225 CATGATCTTCAAATAGCTGATGG + Intronic
907841696 1:58164395-58164417 GAACATATCAAAATAGCTGATGG + Intronic
909047777 1:70730759-70730781 TAGGATATTTAAATAGCCTGGGG - Intergenic
909583060 1:77259891-77259913 AAGAAAATTAAAATAGATGAAGG + Intergenic
911768153 1:101704158-101704180 TAGTATTTTAAAATAGATGTTGG - Intergenic
911778100 1:101840763-101840785 AAGGGTATTAAAATAATTGATGG - Intronic
912730460 1:112097975-112097997 TAGTAAGTTAAAATTGCTGATGG + Intergenic
914409338 1:147410557-147410579 TACTATGTTAAAATAGCTAAAGG - Intergenic
914438796 1:147683327-147683349 TAATATATTAAAAGTGCTGAAGG + Intergenic
915260859 1:154675826-154675848 TAAGACATTAAAACAGTTGAGGG + Intergenic
915785847 1:158611079-158611101 TAGGATCTTAAAAAATCTCAAGG - Exonic
916886030 1:169069138-169069160 TATGCTAATAAGATAGCTGATGG - Intergenic
916939821 1:169666364-169666386 TAAGACATTAAAACAGTTGAGGG + Intronic
918012253 1:180598179-180598201 TTGGATATCAAAATATCTCACGG + Intergenic
918178085 1:182062388-182062410 CAGGGCATTAAAATAGGTGATGG + Intergenic
918246231 1:182661962-182661984 AAGGAAATTGAAATTGCTGATGG - Intronic
919208354 1:194447635-194447657 TAAGTTATTAAAATAGCAGTAGG - Intergenic
919561320 1:199123503-199123525 TAAAATATTAAAATATGTGATGG + Intergenic
919733964 1:200933083-200933105 TAGTATTTTAAAATATCTGATGG + Intergenic
919881192 1:201902091-201902113 TAGAATTTTAAAATATCGGATGG - Intronic
920354243 1:205358614-205358636 TAGGATATGAAATTAGGAGAGGG - Intergenic
920602683 1:207345523-207345545 TGTGATATTAAAAAAGCTCAGGG - Intronic
921471418 1:215555274-215555296 TAATATATTCAAAGAGCTGAAGG - Intergenic
921539641 1:216398122-216398144 TACCATTTTAAAATAGCTGTTGG - Intronic
923329281 1:232907748-232907770 GAAGATAATAAAATAGCTGTTGG - Intergenic
1063142778 10:3270175-3270197 TAGGATATTGAAATAGCATGGGG + Intergenic
1063321415 10:5055895-5055917 TAAGACATTAAAACAGTTGAGGG - Intronic
1064894058 10:20214009-20214031 TAGAATATTAAACAAGATGAAGG - Intronic
1068275781 10:54793763-54793785 TAGGATAAAAAATGAGCTGATGG + Intronic
1068554121 10:58439156-58439178 TAGGAAATGAGAATACCTGATGG + Intergenic
1069855325 10:71437419-71437441 TAGGAGATAATAATAGCTCATGG - Intronic
1071239389 10:83687527-83687549 TAAGATATTAAAATATTAGAAGG + Intergenic
1071365337 10:84893563-84893585 TAGAATAGTAAAAAAGCAGAGGG - Intergenic
1072704538 10:97671175-97671197 TAGGAGAGTACAAAAGCTGAAGG - Intronic
1073188828 10:101635528-101635550 GAGAATATTAAAAGAGGTGATGG + Intronic
1073507427 10:104011242-104011264 TAGGACATAAAAATAGAGGATGG + Intronic
1074638827 10:115354485-115354507 TAGCATATTAAAAGTGCTAAAGG - Intronic
1074664073 10:115697869-115697891 TTGTAAATTAAAATAGATGAAGG + Intronic
1074800822 10:116999434-116999456 TTGGATATTACAATGGCTTATGG + Intronic
1075826874 10:125364712-125364734 TAAAATATTCAAATAGCTAAAGG + Intergenic
1076278077 10:129222634-129222656 CAGGATATTAAAATAACTTATGG - Intergenic
1077877677 11:6321252-6321274 AAGGATTTTAAAAGAGGTGAAGG - Intergenic
1078149524 11:8746830-8746852 TGGGATAATAAAATAACAGAAGG + Intronic
1078757163 11:14222038-14222060 TAGGATGATAAAATATCTCATGG - Intronic
1079599766 11:22296568-22296590 TAGATTTTTAAAATAGGTGAAGG + Intergenic
1079730916 11:23937237-23937259 TAAGACATTAAAACAGTTGAGGG - Intergenic
1080302191 11:30797187-30797209 TAGGTCATTGAAATGGCTGAGGG - Intergenic
1081212372 11:40352873-40352895 TAACATATTAAAAGTGCTGAAGG - Intronic
1081335571 11:41861895-41861917 AAGGAAATTAAAAGCGCTGATGG - Intergenic
1084211309 11:67624364-67624386 TAAGACATTAAAACAGTTGAGGG + Intergenic
1085860532 11:80228329-80228351 TATGATAAGAAAATATCTGATGG + Intergenic
1086820945 11:91435319-91435341 TTGTTTATTAAAATGGCTGAAGG + Intergenic
1087993488 11:104774975-104774997 TGGGATCTTAACAGAGCTGAAGG + Intergenic
1088175478 11:107048525-107048547 CAGGTTATGAAAATACCTGAGGG - Intergenic
1089008911 11:115116660-115116682 TAGGATATAAAAATAGCTGGAGG + Intergenic
1089237618 11:117045510-117045532 CAGAATATTAAAATGGCTTATGG - Intronic
1090225067 11:125065114-125065136 AAGAATTTTAAAATAGCTCAAGG + Intronic
1090318092 11:125815506-125815528 TGGGATATTTAAAGTGCTGAGGG - Intergenic
1091500814 12:1015961-1015983 TATAATATTTAAATAGCTAATGG + Intronic
1093345548 12:18035624-18035646 TAAGACATTAAAACAGTTGAGGG + Intergenic
1093891674 12:24528806-24528828 TAAGACTTTAAATTAGCTGATGG - Intergenic
1094250500 12:28354545-28354567 TAGTATATTTAAATATATGAAGG + Intronic
1095495778 12:42782140-42782162 TTGGATAATCCAATAGCTGAGGG - Intergenic
1096933317 12:55240979-55241001 TTGGATATGAAAATAGTTGCAGG - Intergenic
1097450338 12:59730428-59730450 TAGTATATTAATATAACTGTGGG + Intronic
1097667314 12:62494804-62494826 TAGGATATTACAATTTTTGAGGG + Intronic
1099251494 12:80260822-80260844 AAGGATAATAAAATAGGTCAGGG - Intronic
1099342299 12:81452498-81452520 TATGAAATTGAAATAGCTGTTGG + Intronic
1104166970 12:126241374-126241396 AATGATATCAAAATATCTGAGGG + Intergenic
1107633157 13:42363374-42363396 TAGAATATTTCCATAGCTGAGGG - Intergenic
1108541927 13:51453161-51453183 TAGCATATTTAAACAGCTCAGGG + Intronic
1108824260 13:54392410-54392432 TAGAGTATTAAAATACATGAAGG + Intergenic
1109593872 13:64524021-64524043 TATTATGTTAAACTAGCTGAAGG - Intergenic
1109929813 13:69200916-69200938 TAGATTTTTAAAATACCTGAGGG + Intergenic
1110070647 13:71172664-71172686 AAGGAAATTAAGATAGCAGATGG - Intergenic
1112429179 13:99335111-99335133 TATGAAGTTAAAATAGCTAATGG + Intronic
1116257383 14:42573050-42573072 TAGCATATTCAAATTGCTGAAGG + Intergenic
1117060623 14:51958776-51958798 TAGGATTTTATATTAGCTCAGGG - Intronic
1117444217 14:55788299-55788321 CTGGATGTGAAAATAGCTGATGG - Intergenic
1117947532 14:61044516-61044538 TAGAGTCTTAAAATATCTGAAGG - Intronic
1117963267 14:61182923-61182945 AATGATATTAAAATAACAGAAGG + Intergenic
1118178449 14:63466177-63466199 TGGGCTGTTAAAATAGCTGCAGG - Intronic
1119458254 14:74775290-74775312 TAGGATATAAAAAGAGGGGAAGG + Intronic
1119713564 14:76841680-76841702 AAGAATATAAAAATACCTGAAGG - Intronic
1120654962 14:87178535-87178557 TAAGAAAATAAAATAGTTGAAGG - Intergenic
1123961245 15:25403070-25403092 TTGGATATTAGCAGAGCTGATGG - Intronic
1125433940 15:39626054-39626076 TAAGGTATTTAAATAGCTAATGG - Intronic
1125816605 15:42590416-42590438 TCAGATATCAAAATATCTGAGGG + Intronic
1126138835 15:45419463-45419485 TAGGAAAAAAAAAAAGCTGAAGG + Intronic
1127383591 15:58449938-58449960 GAGGACATTAGAATATCTGATGG - Intronic
1129541469 15:76351726-76351748 AATGATATTAAAATAGCAGCTGG - Intronic
1130303733 15:82699382-82699404 GAGGATAGTAAAATATTTGAGGG - Intronic
1131586606 15:93702545-93702567 TAGGAGATTTAGAAAGCTGAAGG + Intergenic
1131719402 15:95150905-95150927 AAGGATAGTAAAATGTCTGATGG - Intergenic
1131769301 15:95717682-95717704 TATAATAATAAAATAGGTGATGG + Intergenic
1132422474 15:101683862-101683884 TAGGTTAATAAAATCACTGAAGG + Intronic
1135072365 16:19363193-19363215 TAAGATATTAATATAAATGATGG - Intergenic
1135588981 16:23691876-23691898 TGGGATATTAGATTAGCTGAGGG - Intronic
1139158818 16:64478088-64478110 CAGGAAATTAAAATGGCAGAGGG + Intergenic
1143284593 17:5779834-5779856 TATGACAATAAAATAGTTGAGGG + Intronic
1150806260 17:68321574-68321596 AAGGAATTTAAAATAGATGATGG - Intronic
1151041310 17:70863739-70863761 TGTGATAATAAGATAGCTGAGGG - Intergenic
1151149182 17:72068997-72069019 TAGAATATCACACTAGCTGAGGG - Intergenic
1152958474 18:62135-62157 TGACATATTAAAAAAGCTGAAGG - Intronic
1153593230 18:6696805-6696827 CAGGATAATAAAATAATTGATGG - Intergenic
1156375215 18:36508756-36508778 TAGGATGATCAAATAGTTGAAGG + Intronic
1157054921 18:44216092-44216114 TTGGATATTTAAAAAGCTGAAGG + Intergenic
1157532957 18:48437821-48437843 TTGTATAATAAAATAGCAGAGGG + Intergenic
1158453147 18:57584783-57584805 TAGGATAATAAAAGAGTTGTAGG - Intronic
1159926485 18:74274117-74274139 TAGCAGAGTAAAATAGCAGAAGG + Intronic
1168455625 19:56506153-56506175 TAGGAAATTAAAAGAGCTGTAGG - Intergenic
925125328 2:1450695-1450717 TAGGACATTACAATGGCTCAAGG - Intronic
925149636 2:1606348-1606370 TGGGATATTAAAGTACATGACGG + Intergenic
926478827 2:13360830-13360852 TGGCATATTTAAAGAGCTGAAGG + Intergenic
926794590 2:16608435-16608457 TGCGATCTTAAAATAGATGAGGG - Intronic
927906910 2:26865013-26865035 TAGGAAAGAAAAATTGCTGAGGG - Intronic
928016867 2:27665297-27665319 TAAGAAATTAAAATTGCTGCCGG + Intronic
929362272 2:41107137-41107159 TAAAATATTAATATAGCTAAAGG - Intergenic
930351723 2:50264968-50264990 TAGGAGTTTAAAATAATTGATGG + Intronic
930826629 2:55702111-55702133 TAGGATAATAGAATAGAGGAAGG + Intergenic
935919649 2:107998980-107999002 TAGGATATTATTAGAGATGATGG - Intronic
937755533 2:125533490-125533512 TAAGATAATAAAATAACTTATGG + Intergenic
939429777 2:142088523-142088545 AAGAATATTAGAATAACTGATGG - Intronic
939722229 2:145668095-145668117 AAGAACATAAAAATAGCTGATGG - Intergenic
940864668 2:158806042-158806064 TAGGAGATGTAAATAGCAGAGGG - Intronic
941065866 2:160901973-160901995 TAGCATATTCAAATAATTGAAGG + Intergenic
941490084 2:166132801-166132823 TATGATATAAAAATATCTGAGGG + Intergenic
941619832 2:167764790-167764812 AAGGATATGAAAATAACTAACGG + Intergenic
942478869 2:176360058-176360080 TAAGATATTAACCTAGGTGATGG + Intergenic
942865600 2:180670672-180670694 GAGGATTTTGAAATAGCAGAAGG + Intergenic
945645453 2:212486207-212486229 TAGGACATTAAAGTAACTGGGGG + Intronic
1171819526 20:29821658-29821680 TGACATATTAAAAAAGCTGAAGG - Intergenic
1176853284 21:13937913-13937935 AAGGACATTAAAATTGCTAAAGG - Intergenic
1177003614 21:15643581-15643603 AAGGATTTTAAAATCACTGATGG - Intergenic
1177201158 21:17957659-17957681 CAAGATATTAAAAGAGATGATGG + Intronic
1177216050 21:18130426-18130448 ATGGATATTAAAATAGCTTGAGG + Intronic
1177389303 21:20446070-20446092 TAGAAAATTAAAATAGAAGATGG + Intergenic
1177542505 21:22513480-22513502 TAGGATATTAATTTATCTGGGGG + Intergenic
1182878896 22:33716179-33716201 TAGGAAATTAAAATACAGGATGG + Intronic
1182959537 22:34459014-34459036 TAAAATATTATAATAGATGATGG - Intergenic
1183887738 22:40898962-40898984 TAGTTTATTAAAATGGATGAAGG - Intronic
949394255 3:3597904-3597926 TAGCATATTAAAAGTTCTGAGGG + Intergenic
949527062 3:4915473-4915495 TAGGATATTATAATTGCTCAAGG + Intergenic
950055950 3:10024772-10024794 TAGGGTCTTAAAATACCTCAGGG + Intergenic
950203385 3:11060511-11060533 AGGGATATTAAAATATCAGACGG + Intergenic
952597875 3:35041242-35041264 GAGGTTATTAAAATTGCTCAAGG - Intergenic
955251939 3:57291702-57291724 TAGGCAATAAAAATATCTGAAGG - Intronic
957181271 3:76881281-76881303 TAGGATATTAAAATCAAAGAAGG + Intronic
957452936 3:80402863-80402885 AAAGATTTTATAATAGCTGAAGG - Intergenic
957538361 3:81535043-81535065 GAGGAACTTAAAATAGTTGATGG - Intronic
957904029 3:86534825-86534847 TAAGATATTCAAAGTGCTGAAGG + Intergenic
959228187 3:103613711-103613733 TAAGATATAAAAATATATGATGG + Intergenic
959759981 3:109950138-109950160 TAGGATGTTATAATAGCTGTGGG - Intergenic
961924894 3:130468498-130468520 TTGCATATTAAAATAGCTGGAGG + Intronic
961965597 3:130898913-130898935 TAGCATCTTAAAATATCTTAAGG + Intronic
962212293 3:133489297-133489319 CAGGATATGATAATAGTTGATGG - Intergenic
963302872 3:143618397-143618419 TAGAATATTAGGGTAGCTGAAGG + Intronic
964010073 3:151882355-151882377 TATGATAATAAAATACCAGATGG - Exonic
964281338 3:155069808-155069830 TAGGATATTAAAATAGCTGAAGG - Intronic
965531870 3:169778458-169778480 TAGAACACAAAAATAGCTGATGG - Intronic
967729052 3:192890207-192890229 TAGTATATAAAACTAGCTAATGG + Intronic
969152352 4:5180351-5180373 TAGGAAATGAAAATAGCTGTTGG - Intronic
970000589 4:11361986-11362008 TAGGAAATAACAATACCTGAAGG - Intergenic
970174453 4:13324810-13324832 AAGGATAGTAAAAGAGCTGAGGG - Intergenic
971485416 4:27155341-27155363 TAGGATTTAAAAATTCCTGAAGG + Intergenic
973042066 4:45480946-45480968 GAAGATAATAAAATATCTGAGGG - Intergenic
974700660 4:65441175-65441197 TAGGTTATTAAAGGTGCTGATGG - Intronic
974850114 4:67394299-67394321 AAGGATAATAAAAGTGCTGAAGG + Intergenic
975093462 4:70429830-70429852 TATGATATTTAAAAAACTGATGG + Intergenic
975107884 4:70589735-70589757 AAGGAAATTACCATAGCTGATGG - Intergenic
976203035 4:82598600-82598622 TAGGACCTAAAAATAGCTCAGGG + Intergenic
977884358 4:102239642-102239664 TAAGATATTAAAACAGTTGTGGG + Intergenic
978658151 4:111091272-111091294 AAGAATATTAAAATACATGAGGG + Intergenic
979008199 4:115332018-115332040 TCAAATATTTAAATAGCTGAAGG + Intergenic
980269480 4:130565161-130565183 GACCATATTAAAATATCTGAGGG - Intergenic
981147720 4:141344774-141344796 TAGGATATTAACATTTCTAATGG + Intergenic
983199393 4:164844487-164844509 TAGGATGTGAATATATCTGAGGG + Intergenic
984093647 4:175407652-175407674 TAGTATATTAAAGTAGCCCATGG - Intergenic
984310428 4:178051428-178051450 TATGATATTTAAAGTGCTGAAGG - Intergenic
986115874 5:4773956-4773978 CAGGTTATTAAAATAAATGAGGG + Intergenic
986642450 5:9885962-9885984 AAGGATATTAAGAAAACTGAGGG + Intergenic
987930160 5:24391500-24391522 TAAGACATTAAAACAGCTGCGGG + Intergenic
988217699 5:28296766-28296788 TAGCAAATTTAAATAGCTAAGGG + Intergenic
989496453 5:42115203-42115225 TAAGATATTAAAACAGTTGCAGG + Intergenic
989957612 5:50374679-50374701 TAAGACATTAAAACAGTTGAGGG + Intergenic
991224493 5:64254221-64254243 TAGCATCTTAAAACAGCTAAAGG - Intronic
991274848 5:64833461-64833483 AAGGACATTTAAATTGCTGAAGG - Intronic
991663824 5:68976298-68976320 TAGCATATTTAAAGTGCTGAAGG + Intergenic
993744629 5:91581952-91581974 TAGAATTGTAAGATAGCTGACGG - Intergenic
993925351 5:93858635-93858657 TAGGCCATTGAAATAGATGATGG - Intronic
995184381 5:109256397-109256419 TAGGAAATTTAGATAGCCGAGGG + Intergenic
995765585 5:115613379-115613401 TATTTTATTAAAATATCTGAGGG - Intronic
997940935 5:138157001-138157023 TAGGACATTAACATAGCCCATGG + Intronic
999874275 5:155784915-155784937 CAAGATTTTAAAATTGCTGATGG + Intergenic
999980985 5:156957615-156957637 TATGTTGTTAACATAGCTGAGGG - Intronic
1005881320 6:30063183-30063205 GAGAATATTAAAAGAGATGATGG - Intronic
1007998622 6:46335343-46335365 TAGCATATTAAAATAACCAAAGG - Intronic
1008653271 6:53585401-53585423 TGGGATACAAAAAGAGCTGAGGG - Intronic
1008838511 6:55868103-55868125 TATAGCATTAAAATAGCTGAAGG + Intronic
1009032724 6:58080450-58080472 TAGCATTTTAAAATTACTGAGGG + Intergenic
1009208337 6:60832218-60832240 TAGCATTTTAAAATTACTGAGGG + Intergenic
1009407449 6:63328908-63328930 TAAGACATTAAAACAGTTGAAGG - Intergenic
1009471073 6:64028970-64028992 TAAGACATTAAAACAGTTGAGGG + Intronic
1009748308 6:67848517-67848539 TAACATATTTAAATTGCTGAAGG + Intergenic
1012301802 6:97598724-97598746 TAGGATGTAAGAATAGCTCAAGG - Intergenic
1013833613 6:114304939-114304961 TAGCTTTTTAAAATAGCTGTGGG + Intronic
1015731365 6:136351663-136351685 TAAAATATTCAAACAGCTGAAGG + Intronic
1017223881 6:151997497-151997519 TAGGATAATATTATAGCTGTAGG + Intronic
1017767802 6:157621178-157621200 TTAAATATTAAACTAGCTGAAGG - Intronic
1019151289 6:170007653-170007675 TAGGAGATAAAAAAGGCTGAGGG - Intergenic
1020569599 7:9842638-9842660 TAAGATTACAAAATAGCTGAGGG - Intergenic
1020861974 7:13504898-13504920 TAGGATTTTACAACAGCAGAAGG - Intergenic
1020985597 7:15130064-15130086 TAAGATATTAAAATTGCAAAGGG - Intergenic
1021569429 7:22049482-22049504 TTGGATATAAAAATAACTGTGGG + Intergenic
1021871152 7:25007460-25007482 TTGGCTTTTAAAATATCTGAAGG - Intergenic
1022174629 7:27861511-27861533 TTGGAAATTAAAACAGGTGATGG - Intronic
1023592438 7:41794203-41794225 TGGGAGATTAATAGAGCTGATGG + Intergenic
1023777291 7:43619997-43620019 TAGGATATTAGCTTATCTGAGGG + Intronic
1027813605 7:82939499-82939521 TATGACATTAAAATAGTTCAGGG + Intronic
1028434821 7:90790698-90790720 TATAATATTAAAATAGCTACGGG - Intronic
1028834903 7:95364094-95364116 AAGGATATTTAAATACCTCATGG - Intronic
1030535248 7:110758116-110758138 TAGTATGTTAATGTAGCTGAAGG + Intronic
1031254146 7:119427444-119427466 TCTGATATAAATATAGCTGAGGG + Intergenic
1031605797 7:123765955-123765977 GAGGAAATTCAAATAGCTTAAGG - Intergenic
1037935333 8:22911666-22911688 TTGGATTTTAAAATAGCTGCCGG - Intronic
1038143415 8:24871074-24871096 TAGGACATTAAAATATCTTTTGG + Intergenic
1040511258 8:48098193-48098215 TAGCATATTTAAAGTGCTGAAGG - Intergenic
1040964805 8:53072752-53072774 TAAGACATTAAAACAGCTCAGGG - Intergenic
1041361657 8:57061199-57061221 TAGGATATCAAAATAACCCAAGG - Intergenic
1042454747 8:68988205-68988227 TAAGATGTGAAAATAGCTAATGG + Intergenic
1044425917 8:92049827-92049849 TAGACTATGAAAATAGTTGAAGG + Intronic
1044511616 8:93086926-93086948 TGGGATATTAGGATAGGTGAAGG + Intergenic
1046173549 8:110545302-110545324 AAGGAAATTAAAATAGCAGCAGG - Intergenic
1046663240 8:116971724-116971746 TAGAGTATTAAAATAGTGGAAGG - Intronic
1047706684 8:127506247-127506269 CAGGATATCACAATAGCAGAGGG + Intergenic
1047868490 8:129056136-129056158 TTGGGTATGAGAATAGCTGAAGG - Intergenic
1050302053 9:4269283-4269305 TATGATATTATAATATCTGTGGG - Intronic
1050545905 9:6708573-6708595 TATTATAAAAAAATAGCTGAAGG - Intergenic
1055802386 9:80052985-80053007 TGGGATATTCAAAGTGCTGAAGG + Intergenic
1055883238 9:81027683-81027705 CATAATATTAAAATAGATGAGGG + Intergenic
1056002801 9:82234847-82234869 TGGGATATTCAAACAGATGATGG - Intergenic
1057288873 9:93787115-93787137 TAGCATATTTAAAGTGCTGAAGG - Intergenic
1186985206 X:15005395-15005417 AAGGATATTAAAACAGCTAAAGG + Intergenic
1187312491 X:18158689-18158711 TAGGATTTTAAAATATATAATGG + Intergenic
1187972064 X:24668751-24668773 TAGAATTTCAAAATAGCAGAAGG + Intronic
1188216044 X:27478394-27478416 AAGGATAATGAAATATCTGAAGG + Intergenic
1189096137 X:38142512-38142534 GAGGAAAACAAAATAGCTGAAGG - Intronic
1192482503 X:71497864-71497886 TAGGACATTAAAACAGTTGTGGG - Intronic
1193887172 X:86996735-86996757 TGGCATATTAAAAATGCTGAAGG - Intergenic
1195591481 X:106633098-106633120 TAGAATATTAAAATAAATGAAGG - Intronic
1195789264 X:108564151-108564173 AAGGATTTTAAAGTAGCTTATGG + Intronic
1198556856 X:137803672-137803694 TGGGATATTTTAATATCTGATGG + Intergenic
1198795237 X:140387530-140387552 TAGGATATTCATACAGATGAAGG - Intergenic
1199058235 X:143323138-143323160 TAGAATATTATAATAGCTGCAGG - Intergenic
1199267136 X:145841420-145841442 TTGGATATTAAACTAGCGTAGGG + Intergenic
1199558845 X:149140874-149140896 TAGGATAATTAACTAGCAGATGG - Intergenic
1200269816 X:154671778-154671800 TAGTATATTCAAAGTGCTGAAGG - Intergenic
1200800778 Y:7385549-7385571 TAAGATATTAAAACAGATGCAGG - Intergenic
1201487818 Y:14510664-14510686 TAAGACATTAAAACAGTTGAGGG + Intergenic
1201530773 Y:14987796-14987818 TAAGATATTAAAACGGCTGTGGG + Intergenic