ID: 964282309

View in Genome Browser
Species Human (GRCh38)
Location 3:155079979-155080001
Sequence CAGTGGGATTCGGGAGAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 235}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964282309_964282321 19 Left 964282309 3:155079979-155080001 CCAACTTCTCCCGAATCCCACTG 0: 1
1: 0
2: 0
3: 17
4: 235
Right 964282321 3:155080021-155080043 GCTGAGGGAGAAAGGTCCAAAGG 0: 1
1: 0
2: 1
3: 24
4: 228
964282309_964282317 4 Left 964282309 3:155079979-155080001 CCAACTTCTCCCGAATCCCACTG 0: 1
1: 0
2: 0
3: 17
4: 235
Right 964282317 3:155080006-155080028 GTCCCAGGAGAGCGAGCTGAGGG 0: 1
1: 0
2: 3
3: 22
4: 211
964282309_964282320 11 Left 964282309 3:155079979-155080001 CCAACTTCTCCCGAATCCCACTG 0: 1
1: 0
2: 0
3: 17
4: 235
Right 964282320 3:155080013-155080035 GAGAGCGAGCTGAGGGAGAAAGG 0: 1
1: 0
2: 6
3: 49
4: 609
964282309_964282316 3 Left 964282309 3:155079979-155080001 CCAACTTCTCCCGAATCCCACTG 0: 1
1: 0
2: 0
3: 17
4: 235
Right 964282316 3:155080005-155080027 AGTCCCAGGAGAGCGAGCTGAGG 0: 1
1: 0
2: 4
3: 22
4: 228
964282309_964282322 20 Left 964282309 3:155079979-155080001 CCAACTTCTCCCGAATCCCACTG 0: 1
1: 0
2: 0
3: 17
4: 235
Right 964282322 3:155080022-155080044 CTGAGGGAGAAAGGTCCAAAGGG 0: 1
1: 0
2: 0
3: 25
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964282309 Original CRISPR CAGTGGGATTCGGGAGAAGT TGG (reversed) Intronic
901215387 1:7552065-7552087 CAGTGGGAGACGGTAGAACTTGG + Intronic
902435397 1:16395319-16395341 CAGTGGGAAGGGGGAGAAGGGGG - Exonic
902512797 1:16975373-16975395 CAGTGGGATTGGGTGGAAGTGGG - Intronic
902737021 1:18407991-18408013 CAGTGGGATTCGGGGTAACCGGG - Intergenic
903016938 1:20367305-20367327 CGGTGGGACTGGGGAGATGTAGG - Intergenic
903275036 1:22216197-22216219 CAGTGGGAATGGGGAGGAGAGGG + Intergenic
904385004 1:30135295-30135317 CAGTGGGATTCTGGAGTGTTAGG + Intergenic
905029205 1:34870287-34870309 AAGTGGGAGTCAGGAGATGTGGG + Intronic
906087513 1:43148549-43148571 CAGTGGCATTCAGGGGAAGCTGG - Intronic
906604970 1:47162117-47162139 TAGATGGATTCGGGAGCAGTAGG + Intergenic
907325901 1:53638532-53638554 CAGTGGGGTTGGGGGGCAGTGGG - Intronic
907396226 1:54191867-54191889 GACTGGGAGTCGGGAGAACTGGG + Intronic
907571139 1:55485100-55485122 CAGTGGGAATCGGGAGGTCTGGG + Intergenic
907919037 1:58895893-58895915 CAGTGGGCTTGGGGTGAAGATGG + Intergenic
908777336 1:67653249-67653271 CAGTGGAAGTGGGGAGGAGTAGG - Intergenic
909314310 1:74196756-74196778 CAGTGGGAATGGTGAGAAGTTGG - Intronic
912114678 1:106390792-106390814 CAGAGCGATTGAGGAGAAGTAGG + Intergenic
913353446 1:117889454-117889476 GGGTGGGATTGGGGAGATGTTGG - Intronic
915648280 1:157289431-157289453 GAGTGGGCTTTGGGAAAAGTGGG - Intergenic
915662397 1:157415070-157415092 GAGTGGGCTTTGGGAAAAGTGGG + Intergenic
916592379 1:166204859-166204881 CAGTGGGAGTTGGGGGAAGAGGG - Intergenic
916882225 1:169030365-169030387 CTGTGGAATTGGGGAGATGTTGG + Intergenic
917986016 1:180319632-180319654 CAGGGGTATAGGGGAGAAGTGGG - Intronic
918206655 1:182315511-182315533 AATTGGGATTAGGAAGAAGTGGG - Intergenic
918464317 1:184806245-184806267 CAGTGGGAGCAGGAAGAAGTTGG + Intronic
920658951 1:207898855-207898877 CAGTGGGATTTGGGTCATGTGGG - Intronic
922247359 1:223813540-223813562 CAGTGGGACAGGGGAGAAGAGGG - Intronic
922895691 1:229098286-229098308 TAGTGGGATTCAGGACATGTGGG - Intergenic
923571743 1:235121890-235121912 CAGTGGGATTCTGGATCAGTGGG + Intronic
1067938129 10:50628431-50628453 CAGTGGGAATCTGGGGAAATAGG - Intergenic
1069615729 10:69805049-69805071 CAGAGGGAATTGGGAGAACTGGG + Intronic
1070485880 10:76930993-76931015 CAGGGGGAATGGGGAGATGTTGG + Intronic
1072114529 10:92357508-92357530 CAGGGGGTGTGGGGAGAAGTGGG - Intergenic
1072188201 10:93061504-93061526 CAGTGGGAGCCGGGGGAAGAAGG - Intronic
1073900019 10:108209389-108209411 TAGGGGGATTGGGGGGAAGTTGG - Intergenic
1074693768 10:116029724-116029746 CAGGAGGATTTGGGAGAACTGGG + Intergenic
1077587583 11:3465745-3465767 CAGTGGGATGAGGAAGAAGCAGG - Intergenic
1080704377 11:34676340-34676362 CAGAGGGATTGGGGAAAACTTGG + Intergenic
1080709923 11:34737204-34737226 CAGTGAGATTTGGAAGAAGAGGG + Intergenic
1082800456 11:57410336-57410358 CAGTGGGGTTGGAGAGAAGTGGG - Intronic
1083902834 11:65652037-65652059 CAGTGACAGTGGGGAGAAGTGGG + Intergenic
1086123067 11:83320578-83320600 CAGTGGTGGTTGGGAGAAGTGGG - Intergenic
1089639849 11:119840471-119840493 CAGTAGGATTTGGGGGAATTTGG + Intergenic
1089671959 11:120062826-120062848 CTGATGGAGTCGGGAGAAGTGGG + Intergenic
1090884605 11:130864925-130864947 CAGAGGGAGTCGGCAGAAGTGGG + Intergenic
1091041409 11:132284763-132284785 CAGTGGCCTTGGGGAGAAGGCGG + Intronic
1091569180 12:1669626-1669648 GAATGGGAATGGGGAGAAGTAGG + Intergenic
1091598839 12:1904230-1904252 CGATGGGGTTGGGGAGAAGTGGG + Intronic
1091669788 12:2444817-2444839 TAGTGGGATTGGTGAGATGTAGG - Intronic
1092764502 12:11840435-11840457 CAGTGGGATTCAGTAAAAGGAGG - Intronic
1094664923 12:32510194-32510216 TAGTGGGAATGGGAAGAAGTGGG + Intronic
1095195621 12:39312380-39312402 CAGTGGGGGTTGGGAGAGGTGGG + Intronic
1096885103 12:54709938-54709960 TGGTGGGATTCTGGAGAAATTGG + Intergenic
1099862255 12:88234965-88234987 CAGTGGGATAGGGGAGAAACAGG - Intergenic
1100068650 12:90682884-90682906 CACTGGGATACGGTAGAAGCTGG - Intergenic
1102356715 12:112243141-112243163 GAGTGGAATTCAGGAGAAGAAGG + Intronic
1102392758 12:112562904-112562926 CAGTAGGGATAGGGAGAAGTGGG - Intergenic
1108148148 13:47501327-47501349 CAGTGGCAGTGGGGAGAAATGGG - Intergenic
1110270580 13:73585099-73585121 CAGTGGGGATGGTGAGAAGTGGG + Intergenic
1112494155 13:99892822-99892844 CTGTGGGAATTGAGAGAAGTGGG - Exonic
1112785764 13:102950542-102950564 CAGTGGGACTTGGGAGACGAAGG - Intergenic
1113246675 13:108404137-108404159 CAGTGGGTTCCTGGAGTAGTTGG + Intergenic
1113517463 13:110914661-110914683 CAGTGGGAGTCGGGGAAAGCGGG - Intronic
1115397636 14:32926578-32926600 CAGTGGGGTAAGGGGGAAGTGGG + Intergenic
1118024536 14:61755597-61755619 TACTGGGATTTGGGAGAAGAAGG - Intergenic
1118313479 14:64709278-64709300 CCATGGGATTAGGGAGAAGAAGG + Intronic
1119429327 14:74555608-74555630 CCGTGGCAGTCGGGTGAAGTCGG + Exonic
1123102690 14:105816338-105816360 CAGTGGGCTTGGGAAGGAGTGGG - Intergenic
1126105339 15:45143425-45143447 CAGTGGCATTAAGCAGAAGTTGG + Intronic
1126346592 15:47701365-47701387 GAGGGGGATTGGGGAGATGTTGG + Intronic
1129912918 15:79243048-79243070 CACTGGGACTCGGGAGACTTAGG + Intergenic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1131501862 15:92975523-92975545 CCATGGGATTTGAGAGAAGTGGG + Intronic
1137808007 16:51325771-51325793 CAGTGGGCTTTGGGAGCTGTGGG - Intergenic
1137935279 16:52629159-52629181 CAGGTGGATTGTGGAGAAGTGGG - Intergenic
1138008372 16:53357374-53357396 CAGTGGGACTTGAGAGATGTGGG + Intergenic
1138673868 16:58636811-58636833 CGGTGGGAATGGGGAGAACTGGG + Intergenic
1139148537 16:64351870-64351892 CACTGGGACTCGGGATAAGAAGG - Intergenic
1139653755 16:68375376-68375398 CAGAAGGATTCGGGAGGAGAAGG + Intronic
1139948417 16:70657243-70657265 CAGAGGGACGTGGGAGAAGTGGG + Intronic
1140665651 16:77224889-77224911 CAGTGGGATGAGGAACAAGTGGG - Intergenic
1141447714 16:84072829-84072851 CAGTGGGGTTCAGGAGAAGATGG - Intronic
1142607369 17:1089577-1089599 CACTGGGCCTCGGGAGAACTCGG - Intronic
1143707785 17:8711532-8711554 CAGTGGGAATCAGGAGAGGGAGG - Intergenic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144537063 17:16100911-16100933 CAGTGGGATGTGGTAGAAGAAGG - Intronic
1145238466 17:21225453-21225475 CGGTGGGAGTCGGGGGCAGTGGG + Intergenic
1148705206 17:49624142-49624164 GAGTGGGACTGGGGAGATGTAGG + Intronic
1151632277 17:75319014-75319036 CAGTGGGATGTGGGAGAGCTGGG + Exonic
1153820895 18:8830474-8830496 CAGTGTCACTCGGGAGAAGATGG - Intronic
1155576040 18:27248047-27248069 CAGTGGAAGTGGGGAGAAGTGGG - Intergenic
1157747854 18:50152165-50152187 CATTGGGACTCGGGATCAGTAGG - Intronic
1157784073 18:50466562-50466584 CTGTGGGGTTCGGTACAAGTGGG + Intergenic
1159040335 18:63318560-63318582 GAGTGGGATGCGGGAGATGTGGG - Exonic
1160009795 18:75097928-75097950 CTGTGGGGTTTGGGAGAGGTTGG + Intergenic
1161607169 19:5221543-5221565 CAGTGGGATTGGGGCTCAGTCGG - Intronic
1163405775 19:17121337-17121359 CACTGGGGTTCGGGAGATGAGGG + Intronic
1164428757 19:28168526-28168548 CAGTGGGATGAGGAACAAGTGGG - Intergenic
1165856399 19:38881242-38881264 CAGTGGGAGTTGGGAGCAGTGGG + Intronic
1167724204 19:51199790-51199812 CACTGGGTTTTGGGAGAAGGGGG + Intergenic
925942931 2:8837415-8837437 CCGCGGGATTGGGGAGGAGTCGG - Intronic
928423343 2:31157225-31157247 CAGTTGGTCTTGGGAGAAGTCGG - Intergenic
930376138 2:50569146-50569168 TAGTGGGGGTTGGGAGAAGTGGG + Intronic
932260225 2:70320791-70320813 CAGTGGGATTCAAGGGCAGTGGG + Intergenic
932356064 2:71069093-71069115 GAGTGGGAGTGGGGAGAAGCGGG + Intronic
932575517 2:72960423-72960445 CAGTGGGCATGGAGAGAAGTGGG - Intronic
937025045 2:118690763-118690785 CAGGGGGATTGAGGAGAAGTTGG - Intergenic
937269410 2:120638581-120638603 CAGCGGGAGCCGGAAGAAGTGGG + Intergenic
937817308 2:126265826-126265848 TAGTGGGAATAGGGAGATGTTGG - Intergenic
938025285 2:127942342-127942364 CGGGGGGAAACGGGAGAAGTAGG + Intronic
941659751 2:168183709-168183731 CAGTGAGATTAGGGAGAGGAAGG - Intronic
944242153 2:197497135-197497157 CAGTGGAAATCAGGAGAGGTAGG - Exonic
945748600 2:213751302-213751324 CAGTGGGATGAGGAACAAGTGGG - Intronic
948010044 2:234645428-234645450 CAGTGGGAGTAGGCAGCAGTGGG - Intergenic
948010052 2:234645461-234645483 CAGTGGGAGTAGGCAGCAGTGGG - Intergenic
948010075 2:234645545-234645567 CAGTGGGAGTAGGCAGCAGTGGG - Intergenic
948010092 2:234645612-234645634 CAGTGGGAGTAGGCAGCAGTGGG - Intergenic
948010100 2:234645645-234645667 CAGTGGGAGTAGGCAGCAGTGGG - Intergenic
948010115 2:234645711-234645733 CAGTGGGAGTAGGCAGCAGTGGG - Intergenic
948010136 2:234645794-234645816 CAGTGGGAGTAGGCAGCAGTGGG - Intergenic
948010198 2:234646048-234646070 CAGTGGGAGTAGGCAGCAGTGGG - Intergenic
948010206 2:234646081-234646103 CAGTGGGAGTAGGCAGCAGTGGG - Intergenic
948010219 2:234646131-234646153 CAGTGGGAGTAGGCAGCAGTGGG - Intergenic
948010232 2:234646181-234646203 CAGTGGGAGTAGGCAGCAGTGGG - Intergenic
948010245 2:234646231-234646253 CAGTGGGAGTAGGCAGCAGTGGG - Intergenic
948010288 2:234646414-234646436 CAGTGGGAGTAGGCAGCAGTGGG - Intergenic
948010296 2:234646447-234646469 CAGTGGGAGTAGGCAGCAGTGGG - Intergenic
948010309 2:234646497-234646519 CAGTGGGAGTAGGCAGCAGTGGG - Intergenic
948010322 2:234646547-234646569 CAGTGGGAGTAGGCAGCAGTGGG - Intergenic
948010335 2:234646597-234646619 CAGTGGGAGTAGGCAGCAGTGGG - Intergenic
948010355 2:234646680-234646702 CAGTGGGAGTAGGCAGCAGTGGG - Intergenic
948010438 2:234646985-234647007 CAGTGGGAGTAGGCAGCAGTGGG - Intergenic
948010451 2:234647035-234647057 CAGTGGGAGTAGGCAGCAGTGGG - Intergenic
948010464 2:234647085-234647107 CAGTGGGAGTAGGCAGCAGTGGG - Intergenic
948010477 2:234647135-234647157 CAGTGGGAGTAGGCAGCAGTGGG - Intergenic
948010520 2:234647318-234647340 CAGTGGGAGTAGGCAGCAGTGGG - Intergenic
948010528 2:234647351-234647373 CAGTGGGAGTAGGCAGCAGTGGG - Intergenic
948010541 2:234647401-234647423 CAGTGGGAGTAGGCAGCAGTGGG - Intergenic
948010554 2:234647451-234647473 CAGTGGGAGTAGGCAGCAGTGGG - Intergenic
948010567 2:234647501-234647523 CAGTGGGAGTAGGCAGCAGTGGG - Intergenic
948010610 2:234647684-234647706 CAGTGGGAGTAGGCAGCAGTGGG - Intergenic
948010618 2:234647717-234647739 CAGTGGGAGTAGGCAGCAGTGGG - Intergenic
948010631 2:234647767-234647789 CAGTGGGAGTAGGCAGCAGTGGG - Intergenic
948010644 2:234647817-234647839 CAGTGGGAGTAGGCAGCAGTGGG - Intergenic
948010657 2:234647867-234647889 CAGTGGGAGTAGGCAGCAGTGGG - Intergenic
948010688 2:234647984-234648006 CAGTGGGAGTAGGCAGCAGTGGG - Intergenic
948010704 2:234648065-234648087 CAGTGGGAGTAGGCAGCAGTGGG - Intergenic
948010717 2:234648115-234648137 CAGTGGGAGTAGGCAGCAGTGGG - Intergenic
948010730 2:234648165-234648187 CAGTGGGAGTAGGCAGCAGTGGG - Intergenic
948010760 2:234648282-234648304 CAGTGGGAGTAGGCAGCAGTGGG - Intergenic
948010773 2:234648332-234648354 CAGTGGGAGTAGGCAGCAGTGGG - Intergenic
948010825 2:234648549-234648571 CAGTGGGAGTAGGCAGCAGTGGG - Intergenic
948010833 2:234648582-234648604 CAGTGGGAGTAGGCAGCAGTGGG - Intergenic
948010846 2:234648632-234648654 CAGTGGGAGTAGGCAGCAGTGGG - Intergenic
948010859 2:234648682-234648704 CAGTGGGAGTAGGCAGCAGTGGG - Intergenic
948010872 2:234648732-234648754 CAGTGGGAGTAGGCAGCAGTGGG - Intergenic
948010892 2:234648815-234648837 CAGTGGGAGTAGGCAGCAGTGGG - Intergenic
948010960 2:234649069-234649091 CAGTGGGAGTAGGCAGCAGTGGG - Intergenic
948010973 2:234649119-234649141 CAGTGGGAGTAGGCAGCAGTGGG - Intergenic
948010986 2:234649169-234649191 CAGTGGGAGTAGGCAGCAGTGGG - Intergenic
948011014 2:234649270-234649292 CAGTGGGAGTAGGCAGCAGTGGG - Intergenic
948011030 2:234649351-234649373 CAGTGGGAGTAGGCAGCAGTGGG - Intergenic
948011043 2:234649401-234649423 CAGTGGGAGTAGGCAGCAGTGGG - Intergenic
948011056 2:234649451-234649473 CAGTGGGAGTAGGCAGCAGTGGG - Intergenic
948011086 2:234649568-234649590 CAGTGGGAGTAGGCAGCAGTGGG - Intergenic
1172093560 20:32449776-32449798 CAGAGGGATGCGGGGGAAGAGGG + Intronic
1172855892 20:38002114-38002136 CAGTGGGGTGGGGTAGAAGTGGG - Intronic
1175085779 20:56457430-56457452 ATGTAGGATTTGGGAGAAGTTGG + Intronic
1175496446 20:59417856-59417878 CACTTGGATTCTGGAGAAGAGGG + Intergenic
1176023308 20:62973487-62973509 CAGTGGGCTTGGGGAGAAGCCGG - Intergenic
1177421212 21:20860259-20860281 CAGTGGGTTTCAGAATAAGTAGG + Intergenic
1179252752 21:39686759-39686781 CAGTGAGATTGGTGAGATGTAGG + Intergenic
1179575738 21:42307209-42307231 CAGTGGGATGGGGGAGCAGAGGG + Intergenic
1180629803 22:17220666-17220688 GAGTGGGACTGGGGAGGAGTGGG - Intronic
1183081238 22:35458033-35458055 GACTGGGATTAGGGAGAGGTGGG + Intergenic
1183588524 22:38767054-38767076 CAGTGGGACTCCGGAGCAGAGGG - Intronic
1184275050 22:43405255-43405277 CAGGCGGATTCGGGAGCAGGTGG + Intergenic
1184509644 22:44926059-44926081 CAGTGGATTTCCGGGGAAGTGGG + Intronic
1185153719 22:49180679-49180701 CAGTGTGAGTCAGGAGAAGGTGG - Intergenic
950050857 3:9987911-9987933 CTCTGAGCTTCGGGAGAAGTTGG + Intronic
950299126 3:11859672-11859694 CACTGAGCTTCAGGAGAAGTTGG + Intergenic
952150297 3:30581652-30581674 CTGTGGGATTAGGCAGAAGCCGG + Intergenic
952859713 3:37802885-37802907 CACTGGGTTTCAGGAAAAGTTGG + Intronic
953300609 3:41771954-41771976 TAGTGGGATTGGGGAGAGGCAGG - Intronic
953809607 3:46100747-46100769 CCATGGGATTAGGGAGAGGTGGG + Intergenic
960268685 3:115650541-115650563 AAGTGGGAATGGGGAGAAGGAGG - Intronic
961927534 3:130497086-130497108 GAGAGGGATTAGGGAGATGTTGG - Intergenic
961953687 3:130777301-130777323 AAGTGGGAATAGGGAGATGTTGG + Intergenic
962132754 3:132699223-132699245 CAGTGAGGATGGGGAGAAGTGGG - Intronic
962598792 3:136975039-136975061 CAGTGGGATACAAGAGAATTTGG - Intronic
963215291 3:142739540-142739562 CAGTTGGGTTGGGGAGTAGTAGG + Intronic
964282309 3:155079979-155080001 CAGTGGGATTCGGGAGAAGTTGG - Intronic
964737573 3:159932244-159932266 GAGTGGCATTTGGGAGATGTTGG - Intergenic
966697583 3:182807301-182807323 CAGTGGTATTCTGGAGATGGTGG + Intronic
966855649 3:184192417-184192439 GAGAGGGGTTCGGGAGAGGTTGG - Intronic
969479502 4:7440568-7440590 CACTGGGCTTCAGGAGAAGGAGG - Intronic
969559088 4:7934567-7934589 CAGGGGCACTCAGGAGAAGTTGG + Intronic
972165632 4:36280790-36280812 CAGTGGGATTGGAGAGAGGGAGG + Intergenic
975098348 4:70483540-70483562 TAGGGGGATGAGGGAGAAGTGGG - Intergenic
977889383 4:102290784-102290806 CTGTGGGGTTGGGGAAAAGTGGG - Intronic
978417972 4:108498699-108498721 AAGTGGGTTTGGGGAGATGTTGG + Intergenic
982583447 4:157207900-157207922 CAGTAGGATTCAGAAGAATTAGG + Intronic
982613410 4:157607320-157607342 GAGGGGGATTGGGGAGATGTTGG + Intergenic
983991871 4:174129681-174129703 TAGTGGGAATGGAGAGAAGTGGG - Intergenic
984057913 4:174951868-174951890 CAAGGGGATTGGGGAGATGTTGG + Intronic
986559421 5:9046018-9046040 CACTGGGCTTCAGGAGAATTGGG + Intronic
986751919 5:10794990-10795012 CCATGGGATCCGGCAGAAGTTGG - Intergenic
987523633 5:19020045-19020067 AAGTGGGGTTAGGGAGAATTTGG - Intergenic
995019309 5:107349038-107349060 TAGTGGGGTTAGGGGGAAGTGGG - Intergenic
1001083481 5:168683871-168683893 AAGGGGGATTCAGGAGAACTCGG - Intronic
1001544748 5:172564019-172564041 CAAGGAGATTCTGGAGAAGTGGG + Intergenic
1001615361 5:173039427-173039449 CAGCGGGATTTGGGAAAAGAGGG - Intergenic
1002816708 6:687781-687803 CACTGGGATGGGTGAGAAGTTGG + Intronic
1003488213 6:6597639-6597661 CTGTGGGATTCGTGTGCAGTAGG + Intronic
1007408775 6:41649650-41649672 CAGAGTCATTCGGCAGAAGTGGG - Exonic
1007654078 6:43441763-43441785 TAGTGGGAGTCAAGAGAAGTAGG - Intronic
1009602627 6:65821854-65821876 TAGTGGGAGTGGGGGGAAGTGGG + Intergenic
1009912052 6:69942506-69942528 GAGTGGGGATAGGGAGAAGTTGG - Intronic
1010569286 6:77458510-77458532 CAGGGGTACTTGGGAGAAGTTGG - Intergenic
1012711570 6:102613568-102613590 CAGTGTGAGGCAGGAGAAGTGGG + Intergenic
1022771537 7:33478200-33478222 CAGTGGGATTCTGAAAATGTTGG + Intronic
1022854347 7:34300688-34300710 AAGTGGGATTGGGGCGATGTGGG + Intergenic
1024046223 7:45587432-45587454 CGGTGGGGTTAGAGAGAAGTTGG + Intronic
1024208462 7:47183652-47183674 CAGTGGGAGTAGAGAGAAGTGGG + Intergenic
1024317193 7:48032111-48032133 GAGTGGGAATGGGGAGATGTTGG + Intergenic
1024369740 7:48567455-48567477 CATTGAGATTGGGGAGTAGTTGG + Intronic
1026737199 7:72956489-72956511 CAGTGGAGTTCGGTTGAAGTTGG + Intergenic
1027106533 7:75408579-75408601 CAGTGGAGTTCGGTTGAAGTTGG - Intronic
1029642142 7:101827933-101827955 GAGGGGGAGTCGGGAGAAGCAGG + Intronic
1030054588 7:105572194-105572216 CAGGGGGATTGGGGAGATGTTGG - Intronic
1035435788 7:158858154-158858176 TAGTGGGTTTAGGGAGAAATGGG - Intronic
1036095046 8:5714545-5714567 GAGTGGGACTGGGGAGGAGTAGG - Intergenic
1036285893 8:7443889-7443911 CAGTGGGTATTGGGAGAAGCCGG - Intronic
1036335580 8:7867640-7867662 CAGTGGGTATTGGGAGAAGCCGG + Intronic
1038400431 8:27280303-27280325 CAGGGGGTGTGGGGAGAAGTGGG - Intergenic
1043606768 8:82010064-82010086 AAGTGGGATTTGGGAGAAGGGGG + Intergenic
1047100633 8:121671798-121671820 CAGTGTAATTCGGGACAAGAAGG + Intergenic
1048196409 8:132335401-132335423 CAGTGAGACTGGAGAGAAGTTGG - Intronic
1054910431 9:70450344-70450366 TAGTGGGATTTGGGACAAGATGG + Intergenic
1055318413 9:75057240-75057262 CAGTGGGAAGGGGGAGAAGAGGG + Intergenic
1058366355 9:104213797-104213819 GGGTGGGAATGGGGAGAAGTTGG - Intergenic
1059671178 9:116493784-116493806 CAGTGGGAGTGGGGGGATGTGGG + Intronic
1061617930 9:131792389-131792411 CAGTGGCATTCGTGGGAAGTGGG - Intergenic
1061633137 9:131886420-131886442 CAGTGGGGGTAGGGAGAAGTGGG - Intronic
1187407834 X:19020080-19020102 CAGAGGGATTGGGGAGATGTTGG + Intronic
1189318053 X:40069651-40069673 CAGAGGGACCTGGGAGAAGTGGG - Intronic
1190449446 X:50563799-50563821 CAGTGGGATTTGTGAGATTTTGG - Intergenic
1192491419 X:71579543-71579565 CAGTGGCTGTGGGGAGAAGTGGG + Intronic
1195773123 X:108373533-108373555 CACTGGGATTCAGGAGACCTGGG - Intronic
1195824040 X:108977836-108977858 TAGTGCGGTTGGGGAGAAGTGGG + Intergenic
1198372644 X:136005897-136005919 CAGTGGGATTCTGGTGGAGAAGG + Intronic
1200147136 X:153932200-153932222 AAGTGGGATTGGGGGGAAGGAGG - Intronic
1201604755 Y:15772445-15772467 GAGTGGGATTGGGGCGATGTGGG - Intergenic