ID: 964284655

View in Genome Browser
Species Human (GRCh38)
Location 3:155104639-155104661
Sequence ATGTTTAAACAGAAGGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 427
Summary {0: 1, 1: 0, 2: 4, 3: 51, 4: 371}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964284653_964284655 -10 Left 964284653 3:155104626-155104648 CCAAAATAACACAATGTTTAAAC 0: 1
1: 0
2: 0
3: 29
4: 450
Right 964284655 3:155104639-155104661 ATGTTTAAACAGAAGGAACATGG 0: 1
1: 0
2: 4
3: 51
4: 371

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964284655 Original CRISPR ATGTTTAAACAGAAGGAACA TGG Intronic
901274971 1:7984075-7984097 ATGCTGAAACTGAAGGAGCAAGG + Intronic
902129193 1:14244094-14244116 TTGTTTTAACAGAAGCCACATGG - Intergenic
902594248 1:17497280-17497302 ATTTTTAAAAAGAAGAAACACGG - Intergenic
903422880 1:23231396-23231418 ATCTTGAAAAAGAAGGAGCACGG + Intergenic
903517529 1:23921909-23921931 AGGTTAAAGCAGAGGGAACATGG - Intergenic
906413940 1:45604294-45604316 ATATCTAGACAGAAGGAAGAAGG - Intronic
908100296 1:60784183-60784205 AATTGTAAACAGAAGGAACAAGG - Intergenic
908812881 1:68001868-68001890 GTATTTAAAGAGGAGGAACAGGG + Intergenic
909031341 1:70544950-70544972 ATGTTTCAAGAGAAGGAAAATGG + Intergenic
909299045 1:73987711-73987733 ATGTTAGATCAGAAGAAACATGG - Intergenic
909754263 1:79203797-79203819 ATGTCTAAAGAGAAGGATCAGGG + Intergenic
911158680 1:94660932-94660954 ATGTTAAAGGAAAAGGAACAGGG + Intergenic
911221068 1:95247519-95247541 ATGTTCATACAGAATGAACCTGG + Intergenic
911960697 1:104298486-104298508 CTTTTTAAACAGAAAGGACATGG + Intergenic
912185713 1:107273505-107273527 TTTTTTAAATAGAAGGAACAGGG + Intronic
913008428 1:114658146-114658168 AGGTTTAAGGAGAAGGAAGAAGG + Intronic
913129470 1:115826916-115826938 ATAGTGTAACAGAAGGAACAGGG - Intergenic
913460579 1:119082125-119082147 ATTTTTAAAAAGAAAGAAAAAGG + Intronic
913539966 1:119809405-119809427 ATTTTTAAAAATAAAGAACATGG + Intronic
919652205 1:200161472-200161494 ATGTGTATACAGAGGGAAAATGG + Intronic
920117534 1:203631015-203631037 ATGTTAAAACAGAAATGACAGGG + Intronic
920806118 1:209235516-209235538 ATGTTTAGACAGATTGAACATGG + Intergenic
921434083 1:215096732-215096754 ATTTTTAAAGATATGGAACATGG + Intronic
921876168 1:220199043-220199065 ATGATGAAACACAATGAACAGGG + Intronic
923378939 1:233395226-233395248 ATATTTACACAGAAACAACAGGG + Intergenic
923913802 1:238480950-238480972 ATGTTGCAACAGTAGGAAAATGG + Intergenic
1063099608 10:2938039-2938061 ATGTGAAAACAGAAGAAACCTGG - Intergenic
1063295125 10:4797496-4797518 ATGTTAAATCAGTAGAAACACGG - Intronic
1064144431 10:12816227-12816249 CTGTTCAAAAAGAAGGCACAAGG - Intronic
1065987490 10:30969723-30969745 ATGTTTAATAGGATGGAACATGG - Intronic
1066203239 10:33161789-33161811 ATGTTTAAAGAGAACACACAAGG + Intergenic
1066341913 10:34542786-34542808 AATTTTAAAAAGATGGAACAAGG + Intronic
1066396011 10:35022454-35022476 ATGTTTAAGCAGAAGTAACAGGG + Intronic
1067443430 10:46326202-46326224 ATGGATAAAAGGAAGGAACAGGG + Intronic
1067983055 10:51109277-51109299 ATGTTTAAAAAGAAGAAAAAAGG + Intronic
1068168685 10:53364508-53364530 ATGTTATAAAAGAAGGAAGAAGG - Intergenic
1068306326 10:55213026-55213048 GTGTTTGAACAGAAGGAATTAGG - Intronic
1068893777 10:62177480-62177502 ATATTTAATCACAAGGAAAATGG + Intergenic
1069104281 10:64363843-64363865 TTGAGTACACAGAAGGAACAAGG + Intergenic
1069457772 10:68567363-68567385 ATTTTTAAACAGATTGAACCCGG + Intronic
1069529491 10:69205838-69205860 ATTTTTAAACAGAAAACACACGG - Intronic
1070836034 10:79447314-79447336 TTGTTTAAAGAGTAGGTACACGG + Intergenic
1071593007 10:86894141-86894163 ATGTTTAGAAAAAGGGAACAGGG - Intronic
1072313780 10:94182144-94182166 ATTTTGAAACAGGAGGAAAATGG + Intronic
1076572730 10:131443385-131443407 ATTTTTAAACAGAAGTCCCAGGG + Intergenic
1076678084 10:132158339-132158361 ATGTTTGATCACAAGGACCATGG - Intronic
1077670929 11:4157000-4157022 ATTTTTAAAAAGAAAGAAAAAGG - Intergenic
1077810906 11:5635556-5635578 ATGTTTAAAAAAAAGTAACAGGG - Intronic
1078169259 11:8916269-8916291 ATTTTTAAAAAGAAAGTACAAGG + Intronic
1078262287 11:9721226-9721248 CTCTTTAAAGAGAAGTAACAGGG - Intronic
1078618336 11:12885131-12885153 AAGATTAAACAGAAGGAAACAGG + Intronic
1078741574 11:14071568-14071590 ATGTTCTAGGAGAAGGAACAGGG - Intronic
1081391835 11:42538876-42538898 ATTTTTAAATAGCAAGAACAAGG + Intergenic
1085025001 11:73231185-73231207 ATGTTTACTCAGAAGGAAGGGGG - Intronic
1085368028 11:75970794-75970816 ATGTTTTAACAGAAGAAATTGGG - Intronic
1085847742 11:80085128-80085150 ATGAATAAAAAGAAGGAAAAAGG - Intergenic
1086156741 11:83675469-83675491 AGGTTTAATCAGAAGTAAAAAGG + Intronic
1086747294 11:90445539-90445561 ATGTTGCAAGGGAAGGAACATGG - Intergenic
1087674716 11:101147183-101147205 ATGTGTAAACAAAAAGAAAAGGG - Intergenic
1087727929 11:101743527-101743549 ATATGGAAACAGAAGGAAGAAGG + Intronic
1088067663 11:105740804-105740826 AAGTTTAAATAGAAGAAAAAGGG + Intronic
1088466745 11:110147803-110147825 ATGATGAAGAAGAAGGAACAAGG - Intronic
1088551312 11:111015010-111015032 AAGTTTAAAAAGAAAGAATAAGG + Intergenic
1089643440 11:119862829-119862851 ATGTTTAAAAAGAAGGGAGGAGG - Intergenic
1091204782 11:133812729-133812751 GTGTAAAAACAGAAGGAAAATGG + Intergenic
1092745885 12:11672153-11672175 ATTTTGCGACAGAAGGAACAGGG - Intronic
1092994766 12:13939437-13939459 ATGTGGCAACAGAAGGAGCAAGG - Intronic
1093264036 12:16979272-16979294 ATGTTACAACATAAGGAACTAGG - Intergenic
1094193567 12:27721775-27721797 ACATTTAAAAAGAAGAAACATGG - Intronic
1094355023 12:29567813-29567835 ACGTTCAAACAGAAGAAATAAGG - Intronic
1095861902 12:46926524-46926546 AAGTTTAAAAAGAAGGAAAAAGG + Intergenic
1096669618 12:53190831-53190853 ATATTTAAATAAAAGGAAAATGG + Exonic
1096755163 12:53793379-53793401 CTTTTTAAGCAGATGGAACAGGG + Intergenic
1097970782 12:65630997-65631019 ATTTTTAATCAGAAGAAACGAGG + Intergenic
1098683809 12:73394686-73394708 ATTTTTAAAAAGCAGGAAAAAGG + Intergenic
1099943567 12:89218927-89218949 ATGTTTGAACAGATGAAGCATGG - Intergenic
1100244666 12:92745166-92745188 AAGCTTAAACAGAAGTAAAAGGG + Intronic
1102840433 12:116114098-116114120 ATGTTTAAAAAAAAGGAAAAGGG - Intronic
1105761988 13:23523683-23523705 AGGTTTAAACAGGGGGAATAAGG - Intergenic
1106343454 13:28853333-28853355 ATATGTAACCAGTAGGAACATGG - Intronic
1106457610 13:29940844-29940866 AGGATTAAACAGAAGAAAAATGG + Intergenic
1107607325 13:42072741-42072763 ATTTTTAAACAAAAGAAAAAGGG + Intronic
1107729372 13:43332838-43332860 ATGTATATACAGAAGAAAAAAGG + Intronic
1107923372 13:45233379-45233401 ATAATTAACCAGAAGAAACATGG + Intronic
1108378780 13:49837405-49837427 AAGTTTAAACAAAATGAAAAAGG + Intergenic
1109286473 13:60414928-60414950 CTGCTTAAACAGAGGGAAAAGGG + Intronic
1110155037 13:72306561-72306583 ATTTTTAAATAGAAAGACCAGGG + Intergenic
1110252746 13:73398975-73398997 ATGTTGATACAGAAAGGACATGG - Intergenic
1111043083 13:82777007-82777029 ATGATTACACAGAAGGAAAATGG - Intergenic
1111433124 13:88170077-88170099 ATATATAAACAAAAGAAACAGGG - Intergenic
1112274879 13:98007260-98007282 ATATTTAAAGGGAACGAACATGG - Intronic
1112686401 13:101832892-101832914 ATGTTTAAAAAGAACTACCAGGG + Intronic
1112910821 13:104481302-104481324 ATATTTAAATAGAAAGAACAAGG + Intergenic
1113628073 13:111861174-111861196 ATGTTTAGAAAGAAGGGACATGG + Intergenic
1113628079 13:111861216-111861238 ATGTTTAGAAAGAAGGGACATGG + Intergenic
1113628085 13:111861258-111861280 ATGTTTAGAAAGAAGGGACATGG + Intergenic
1113674839 13:112199987-112200009 TTGTTTAAACACAAGGAGCTGGG + Intergenic
1116082537 14:40193135-40193157 ATGTTTCATCACAAGGAACTAGG + Intergenic
1117043094 14:51785809-51785831 AAGTTTAAAAAGAAAGAAAACGG - Intergenic
1117236846 14:53786951-53786973 ATGTTTAAGGAGAAAGAAAAAGG - Intergenic
1117287918 14:54305558-54305580 ATGATCAAACAGAAGGAAGAAGG + Intergenic
1118181069 14:63493935-63493957 CTGTTTAAACTGTAGGAAGAAGG + Intronic
1118491236 14:66262945-66262967 ACATTAAAACAGAAGGTACATGG - Intergenic
1118567152 14:67153959-67153981 ATGTTCAAAAAGAATGAAAAGGG + Intronic
1120050719 14:79862391-79862413 ATAATTAAACAGAAAAAACATGG - Exonic
1120155063 14:81084392-81084414 AGGTTTAAAAAGAAGGAATGTGG - Intronic
1120318410 14:82927647-82927669 ATGTAAAAACAGGAGGGACATGG - Intergenic
1120560150 14:85981672-85981694 ATGCTTAAGCAGAAGGAAGCAGG - Intergenic
1120630132 14:86880539-86880561 ATGGTTAGACAGAAGTGACATGG - Intergenic
1121962138 14:98271082-98271104 TTGTTTAACTAAAAGGAACATGG + Intergenic
1124101514 15:26698612-26698634 ATGATAAAACAGAATGAAGAGGG + Intronic
1125828721 15:42696051-42696073 ATGAATGAACAGAAGGAGCAGGG - Intronic
1125874915 15:43135423-43135445 ATATGTACACTGAAGGAACAAGG - Intronic
1128313222 15:66644602-66644624 AATTTTAAACAGGAAGAACAAGG - Intronic
1128950422 15:71874408-71874430 TAGCTTAAACAGAAGGAACCAGG + Intronic
1129814262 15:78538294-78538316 ATCTTTAAACCCAAGGAAAAGGG + Intergenic
1129980976 15:79870655-79870677 ATGCTATAACAGTAGGAACAAGG + Intronic
1130112529 15:80977501-80977523 AAGTGGAAACAGAAGGTACAGGG + Exonic
1130447862 15:84020967-84020989 ATGATTTAGCAGGAGGAACAGGG - Intronic
1131013544 15:89039076-89039098 ATGTTTAAAAAGAAAGAAGTCGG - Intergenic
1131049374 15:89336035-89336057 ATATTTAAATAGAAGGGACCAGG - Intergenic
1131435802 15:92420625-92420647 ATGTTTAAATTGAAGGCAGAAGG + Intronic
1132516375 16:367984-368006 ATGGATAAACAGAGGGAATAGGG + Intronic
1133363115 16:5189604-5189626 ATGTCTAAACTGAAGTAGCATGG - Intergenic
1138119895 16:54391618-54391640 TTGCTTAGAAAGAAGGAACAAGG + Intergenic
1138708139 16:58938873-58938895 CTTTTTAAACAGAGCGAACATGG + Intergenic
1139060783 16:63248988-63249010 TTGTATAAACAGAAAAAACAAGG + Intergenic
1139819085 16:69705614-69705636 ATGTTTAAATGAAAGGAAAAAGG + Intergenic
1140578614 16:76202368-76202390 ATGTATGATCAGATGGAACAGGG + Intergenic
1140798960 16:78467153-78467175 TTTTTTAAAAAGAAGGAAAATGG - Intronic
1140803633 16:78511915-78511937 ATGTGTAAACAGAAGTAGCTGGG - Intronic
1141023815 16:80524299-80524321 ATGTTTAGACATAAGGTAAATGG + Intergenic
1141144453 16:81519140-81519162 ATTTTTTAACAGAAGTAGCAGGG + Intronic
1143565854 17:7720101-7720123 ATTTTAAGACAGAAAGAACAAGG - Intronic
1144223254 17:13119596-13119618 ATCTTTAAACAAAAGGAGAAAGG - Intergenic
1144228010 17:13170652-13170674 TGGCTTAAACAGTAGGAACATGG - Intergenic
1144317239 17:14073577-14073599 ATGTTCAGAAAGAGGGAACATGG + Intronic
1146094158 17:29912349-29912371 AAATTTAAACAGTAGGAATATGG - Intronic
1148173680 17:45546101-45546123 ATGTTTCAACAGAGGGCACTGGG - Intergenic
1148275589 17:46299347-46299369 ATGTTTCAACAGAGGGCACTGGG + Intronic
1148297698 17:46516915-46516937 ATGTTTCAACAGAGGGCACTGGG + Intronic
1148362247 17:47021403-47021425 ATGTTTCAACAGAGGGCACTGGG + Intronic
1148897517 17:50847912-50847934 ATGTTTAAAAAGAGGGCCCAGGG + Intergenic
1150404888 17:64893025-64893047 ATGTTTCAACAGAGGGCACTGGG - Intronic
1153413180 18:4816655-4816677 ATCTTTAAACTGAAGGAAAATGG + Intergenic
1153645695 18:7194292-7194314 ATGCATAAATACAAGGAACATGG - Intergenic
1154224890 18:12494399-12494421 ATGGTAGAACAGAAGGAGCATGG - Intronic
1155559067 18:27055789-27055811 ATGATATAACAAAAGGAACACGG + Intronic
1155993078 18:32301019-32301041 ATGTTAAAATAAAAGGCACATGG + Intronic
1156031871 18:32722385-32722407 AAGCTTAACCAGAAGGAACCTGG + Intronic
1156440448 18:37181874-37181896 ATGTTTAAAAAGAAGACAAAGGG + Intronic
1156713969 18:39983559-39983581 ATGTTTAACAAGAAGAGACATGG - Intergenic
1156811103 18:41252800-41252822 ATGTGTAATGAGAAGGAAGAAGG + Intergenic
1156824112 18:41409229-41409251 AAGTTTGAACAGAAGGATTAGGG + Intergenic
1157735149 18:50041064-50041086 ACATTTAAACAGGAGGAACTTGG + Intronic
1157957986 18:52120295-52120317 ATGTTGAAAGAGAAAGAATAAGG - Intergenic
1160320307 18:77885714-77885736 ATCTTTATAAAGAAGGAACAAGG + Intergenic
1162317507 19:9948642-9948664 ATGTTTAAACAGAAACAAAATGG + Intergenic
1162715895 19:12633141-12633163 ATGTTTAATAAAAAGGAAAATGG - Intronic
1163070220 19:14833869-14833891 ATTTTTAAACAGATGGCAAACGG + Intronic
1165184480 19:34005420-34005442 ATCTTAAAACAAAAGGAACAAGG + Intergenic
1166406159 19:42523289-42523311 ATGTTTCAGCAGAAATAACAGGG + Intronic
925534161 2:4899041-4899063 ATGTTTTAAAAGAAGGTGCATGG + Intergenic
925797164 2:7558328-7558350 TTGTACAAACAAAAGGAACATGG - Intergenic
925985210 2:9209528-9209550 ATGTTTAAACAAATGAATCACGG + Intronic
928773290 2:34728165-34728187 ATTTTTAAAAAGAAGAAAGATGG + Intergenic
929030823 2:37648749-37648771 ATGTTTTAACAGGAAGAACATGG - Intronic
929944304 2:46358958-46358980 GTGTTTAGAAAGAATGAACAAGG + Intronic
930557778 2:52921712-52921734 ACAATTAAACAGAAGGAAAATGG - Intergenic
932079906 2:68704451-68704473 ATATTTAAAAAAAAGAAACAAGG + Intronic
933117276 2:78489969-78489991 AAGTTTAAAAAAAAGGAAAATGG + Intergenic
933917925 2:87015094-87015116 ATTGTTAACCAGAAGGAACATGG - Intronic
934005070 2:87754820-87754842 ATTGTTAACCAGAAGGAACATGG + Intronic
934887466 2:98037602-98037624 ATGCTTATAAAGAAGGAAAAAGG + Intergenic
935192081 2:100786328-100786350 AAGTTTTAAAAGAAGTAACACGG + Intergenic
935768031 2:106388860-106388882 ATTGTTAACCAGAAGGAACATGG + Intergenic
936606132 2:113956496-113956518 ATACTTAAACAGAACAAACAAGG - Intronic
937862878 2:126724852-126724874 GTGTTTAACCAGAAGGAAGAGGG - Intergenic
938563328 2:132494397-132494419 ATGAGAAAACAGAAGGAACAAGG - Intronic
938624856 2:133097084-133097106 AAGTTTGAACTGACGGAACAAGG + Intronic
939962166 2:148574976-148574998 ATGTTTAGAAAGTAGCAACATGG + Intergenic
940014886 2:149093530-149093552 ATGTTTAAAGAGATGGCCCATGG - Intronic
942204435 2:173605364-173605386 AAGTTAAGATAGAAGGAACAGGG - Intergenic
942593454 2:177570002-177570024 CTGTTTAAATAGAAAGAATAGGG + Intergenic
942898122 2:181082952-181082974 ACATTTTAACAGAAGGAATATGG - Intergenic
942969193 2:181936967-181936989 ATTTTTAAAAATAAGAAACACGG - Intergenic
943656303 2:190512635-190512657 ATGGTTAAAGGGAAGGAAGAAGG + Intronic
944425793 2:199581876-199581898 ATTTTTAAAAAGAATGATCACGG + Intergenic
945644806 2:212477900-212477922 ATGTGTGAAAAGAAAGAACAGGG + Intronic
946872725 2:224099148-224099170 ATTTCTAAACAGAACTAACATGG - Intergenic
947018035 2:225643319-225643341 ATGTTTAAGCACAAGGAACATGG - Intronic
947102354 2:226634905-226634927 ATGTTGAAACCCAAGGAAGATGG - Intergenic
948474102 2:238205487-238205509 ATTTTTAACCAGCAGGATCATGG - Intergenic
948810242 2:240471573-240471595 ATTTTTAAAAAGAAAAAACAAGG + Intergenic
1169556183 20:6752731-6752753 ATATTTAAACAGGAGAATCAAGG - Intergenic
1169766584 20:9153663-9153685 ATGTTTAAAGAGGAGCCACAAGG + Intronic
1170368716 20:15625058-15625080 ATATTTAAACAGAAGGAAAAGGG - Intronic
1170790855 20:19508372-19508394 ATGTCTGAGCAAAAGGAACATGG - Intronic
1171507433 20:25649446-25649468 ATTTTTAAAAAGAAGAAAAAAGG - Intergenic
1172329958 20:34068608-34068630 ATGTTTAAACATATGGTACATGG - Intronic
1173632027 20:44523720-44523742 ATTTTTATCCAGAAGGAAGAAGG + Intergenic
1174008966 20:47433557-47433579 ATTTTTAAAAAAAAGGAAAAAGG + Intergenic
1174158615 20:48534298-48534320 ATTTTTAAACTGAAAGAAGATGG - Intergenic
1174462602 20:50693410-50693432 TTTTTTAAAAAGAAGGAAGATGG - Intergenic
1175819842 20:61903109-61903131 ATGTGCAAACATAATGAACAAGG - Intronic
1176073093 20:63236820-63236842 ATGTTTAAAGAACAGGATCAGGG + Intronic
1176720227 21:10386717-10386739 TTATTTAAATAGAAGGAAGAAGG + Intergenic
1177490149 21:21813382-21813404 ATCTTTGAACAGAAGGTAAATGG + Intergenic
1177902831 21:26937897-26937919 ATGTTAAAACAAAAGGAAGAAGG - Intronic
1177926997 21:27229760-27229782 ATGTTAAAATAAAAGAAACAAGG + Intergenic
1178340630 21:31783158-31783180 ATGTTTTCACACAAGGAAGAGGG - Intergenic
1178934772 21:36851875-36851897 ATTTTTAAACATTAGGAAAAAGG + Intronic
1179187254 21:39094376-39094398 ATGTTCAAACCCAAAGAACAAGG + Intergenic
1180301426 22:11039477-11039499 TTATTTAAATAGAAGGAAGAAGG + Intergenic
1180943302 22:19674557-19674579 ATGATCCAACAGAAAGAACAAGG - Intergenic
1182851626 22:33479383-33479405 ATGAACAAACAGAAGGAAGAGGG + Intronic
1183580563 22:38723639-38723661 ATTTGGAACCAGAAGGAACAAGG - Intronic
1183887075 22:40892932-40892954 ATATTATAACAGATGGAACATGG + Intronic
1183989900 22:41590683-41590705 ATGTGTGGACAGAAGGAATAAGG - Intergenic
1184050958 22:42004290-42004312 AAATTTAAAAAGAAGGAACAAGG + Intronic
949643220 3:6063586-6063608 GTTTTTAAACAGAAGGAAATAGG + Intergenic
951116949 3:18874841-18874863 TTATCTGAACAGAAGGAACAAGG - Intergenic
951117011 3:18875736-18875758 ATGTTTAAACAAAAGAACCAGGG - Intergenic
951701731 3:25503733-25503755 AAGTTGAAACAGAAGGAAGCAGG + Intronic
952788789 3:37181619-37181641 ATGTTTAAGGAGCAGTAACAAGG + Intronic
952912226 3:38200548-38200570 ATATTTAAAGGGGAGGAACAGGG + Intronic
953772829 3:45792075-45792097 AGGTTAGAACAGAAGGGACAAGG + Intronic
955762098 3:62297507-62297529 TAGTTTAAACAGAAGAAAAAGGG - Exonic
956344918 3:68268037-68268059 ATTTTTCAACACAAAGAACAAGG - Intronic
956859540 3:73308760-73308782 ATTTTTAAACAGAAGCTCCAGGG + Intergenic
957935654 3:86938379-86938401 AGCTTTCAACAGAAGGAATAGGG + Exonic
958595924 3:96222842-96222864 ATGTTGCAACAGAAGTAAAATGG + Intergenic
959174159 3:102884277-102884299 ACATTTAAACAGAAAGAAAAAGG - Intergenic
959890293 3:111547315-111547337 ATATATAAAAAGAAGGAGCAGGG - Intronic
960242824 3:115365749-115365771 CTGTTTCAACAGTAGGAAAAAGG + Intergenic
960253184 3:115480367-115480389 ATGTTTCAGAAGATGGAACAAGG + Intergenic
960493153 3:118342213-118342235 ATACTTAAACAAAAGGAAAAGGG - Intergenic
960546822 3:118924839-118924861 TTGTTTAAAAAAAAGCAACAAGG + Intronic
961135262 3:124504282-124504304 TTTTTTAAACAGAAGGAAGAGGG - Intronic
963775062 3:149430417-149430439 ATGTTTAAACAGAAGCCAGATGG - Intergenic
964284655 3:155104639-155104661 ATGTTTAAACAGAAGGAACATGG + Intronic
966045431 3:175542885-175542907 ATGAATAAACAGGAGGAAAATGG + Intronic
966276095 3:178171821-178171843 ATACTTAAACAGAAAGACCAAGG + Intergenic
966431282 3:179833585-179833607 ATTTCTAAACAGAATGAACTTGG - Intronic
966486588 3:180477947-180477969 ATGTGGAATCAGAAGGAAAAAGG - Intergenic
966983987 3:185163259-185163281 ATGTGTAAATAGAAGCTACAAGG - Intergenic
967113113 3:186312769-186312791 ATGTCAAAACAGAAGGGCCAGGG + Intronic
967431329 3:189389289-189389311 AAGATTAAACAGAAGAAAGATGG - Intergenic
970580898 4:17473156-17473178 ATTTTTAAAAAGAAAGAAAAAGG + Intronic
970892116 4:21058841-21058863 ATTTTTAATCAGAAGAATCAGGG - Intronic
971054027 4:22892447-22892469 GTGTGTAAACTGAAGGTACATGG + Intergenic
971534430 4:27730797-27730819 ATGTATAAACAGAAGCACCTAGG - Intergenic
972185633 4:36524459-36524481 TGGTTTATACAGAAGAAACAGGG - Intergenic
974662656 4:64913708-64913730 AAATTTAAACAGAAGGAATAGGG + Intergenic
974771609 4:66421956-66421978 ATGTTTAAATAGAATAAAGATGG - Intergenic
975380578 4:73696093-73696115 AAGATTAAACTGAAGGACCATGG + Intergenic
975660537 4:76684421-76684443 AGGTTTAAACAGAGGCAAAAAGG - Intronic
976306150 4:83561369-83561391 ATCTTGAAAAAAAAGGAACATGG - Intronic
976878139 4:89882248-89882270 ATGTTTCAATATTAGGAACATGG - Intronic
977207075 4:94175371-94175393 GTGTTTAAAGAGTAGGAAAAGGG - Intergenic
977554459 4:98474646-98474668 ATGATTAAAAAGAAGAAATAAGG - Intronic
977597898 4:98903765-98903787 ATGTTTACACAGAATGATTAAGG + Intronic
978066779 4:104414461-104414483 ATATTTGAACAAAAGGAGCAAGG + Intergenic
978870997 4:113577827-113577849 ATGTCCAAACACATGGAACATGG - Intronic
979362531 4:119782078-119782100 GTGTTTAAACATCAGAAACACGG - Intergenic
979694112 4:123592267-123592289 ACTTTTAAAGAGAAGGAAAAAGG + Intergenic
982148188 4:152421523-152421545 ATGTTTAAAAAGTAGAGACAGGG - Intronic
982894528 4:160901688-160901710 AAGTTTAGGCAGAAAGAACATGG + Intergenic
983600641 4:169523069-169523091 ATATTTAGAGGGAAGGAACAGGG + Intronic
983711672 4:170724529-170724551 ATGCTTAAATAGTAGGAAGAAGG - Intergenic
984167902 4:176324807-176324829 ATATGTAAACAGTAGGAAAATGG + Intronic
984272516 4:177564838-177564860 ATCCTGAAACAAAAGGAACAAGG - Intergenic
984469302 4:180146174-180146196 ATGATTTAATAGAAGGAACATGG + Intergenic
984676739 4:182557631-182557653 ATGCTTAAATAGAAGCCACAGGG + Intronic
985905125 5:2828870-2828892 AGGATTAAACAGAATGAAAAAGG + Intergenic
986124518 5:4872951-4872973 ATATTTACACAGAAGCACCAGGG - Intergenic
986352867 5:6896159-6896181 ATGTAGAAAGAGAAGGAACGGGG + Intergenic
987214436 5:15718741-15718763 ATGTTTAAAGAAAAGAAAAAAGG - Intronic
988968130 5:36440308-36440330 ATCGTTACACAGAAGGAAGATGG + Intergenic
989540742 5:42615662-42615684 ATGGTTAAACTCAAGAAACAAGG + Intronic
989803298 5:45571998-45572020 ATGTCTAAAGAGAAAGGACATGG - Intronic
990537303 5:56735382-56735404 ATGTATAAACTGAAGCATCAAGG - Intergenic
991027405 5:62045027-62045049 ATATATAAATAGAAGAAACAGGG + Intergenic
991273324 5:64813229-64813251 ATGTCCAAACAGAAGAAAAATGG - Intronic
991393835 5:66182280-66182302 ATATTTAAACACAAGAAACATGG - Exonic
992868530 5:80982429-80982451 ATGTTTAACCTGTAGGAAGAAGG + Intronic
993993779 5:94693764-94693786 TTTTTTAAACAGAAGTAACTTGG + Intronic
994131177 5:96229893-96229915 GTTTTATAACAGAAGGAACACGG - Intergenic
994356940 5:98803332-98803354 ATGTATAAACAGAAGAAGGAAGG + Intergenic
994513031 5:100731981-100732003 GTGTTTAAACAGAAAGTGCAAGG + Intergenic
994525945 5:100904487-100904509 CTGTTCAACCTGAAGGAACACGG - Intergenic
995012981 5:107278358-107278380 TTGTTTAAATACAAGAAACAGGG + Intergenic
995915288 5:117238209-117238231 ATGTTTAAAGAGAATTAACATGG + Intergenic
996307116 5:122059998-122060020 ATGTTGAATAAGAAGGAACTTGG + Intronic
996466814 5:123812200-123812222 ATGTTTAAACTGCAGAAAAATGG - Intergenic
996912628 5:128672658-128672680 ATGTTTAGTCAGAAAGAATAAGG + Intronic
996973859 5:129407309-129407331 ATATTTACACATAAGGAATAAGG + Intergenic
998713705 5:144856041-144856063 TTCTTTAAACAGAAAGAAAATGG - Intergenic
998847745 5:146327230-146327252 AAGTTTATACAGAAGACACAGGG - Intronic
999661442 5:153867362-153867384 ATGTTTAAAAAGGATGAGCAAGG - Intergenic
1000188253 5:158881953-158881975 ATTTTTAAGCAGAAGCAACTAGG - Intronic
1000666718 5:164006804-164006826 ATTTATAAACAGAAGGAAAGAGG + Intergenic
1002819944 6:715599-715621 ATGCATAAACAGATGGAAAATGG + Intergenic
1003226457 6:4210477-4210499 ATGATTGATCAGAAGAAACAGGG + Intergenic
1004782979 6:18932818-18932840 ATGTTAAAAAAGAAAGCACATGG - Intergenic
1004828358 6:19449303-19449325 ATGTTTAAAAAGAACAAAAACGG - Intergenic
1005171776 6:22994077-22994099 ATGTTTAATGGGAAGGAGCAAGG + Intergenic
1005221203 6:23590989-23591011 AAGTTGTAACAGATGGAACAGGG - Intergenic
1005693184 6:28327210-28327232 ATGCATAAACTGAAGGCACAGGG + Intronic
1005764640 6:28998908-28998930 ATATACAAACAGAAGGATCAGGG - Intronic
1005804451 6:29461568-29461590 ACGTTTGATCAGAAGGAACAGGG + Exonic
1005818054 6:29573707-29573729 ATGTTTGATCAGAAGGAACAGGG + Intronic
1005819684 6:29587743-29587765 ATGTTTGACCAGGAAGAACAGGG + Exonic
1005930401 6:30479869-30479891 ATTTTTAAAAAGAAGAAACTTGG + Intergenic
1006805500 6:36786033-36786055 AAATTTAAAAAGAAGGACCACGG + Intronic
1006953809 6:37848729-37848751 ATGTTTAAAAAGAAAAAACTTGG + Intronic
1007731538 6:43950599-43950621 ATGTTTAAACGGGAGGGGCATGG + Intergenic
1008612467 6:53197081-53197103 CACTTTAAACAGAAGGAAAATGG - Intergenic
1008733319 6:54510045-54510067 GTGTTTAGAAAGGAGGAACAGGG + Intergenic
1009433854 6:63595720-63595742 ATGGTGAAAGTGAAGGAACATGG + Intergenic
1010288140 6:74103343-74103365 ATGTTTATACTGAAGGGAAAAGG - Intergenic
1010542350 6:77107394-77107416 ATATTTACAAAGAAGTAACAAGG - Intergenic
1011482246 6:87806580-87806602 TTGTTAAAAGAGAAGGAACAGGG + Intergenic
1012174182 6:96058857-96058879 ATTTTTAGACACAAGAAACAAGG + Intronic
1012209462 6:96501507-96501529 ATTTTTAAAAAGAAGGAATTTGG - Intergenic
1012379594 6:98604342-98604364 AATTTTAAACAGACTGAACAAGG + Intergenic
1012696646 6:102392117-102392139 ATGTTTAATGAGAATGAAGAAGG - Intergenic
1013731025 6:113167695-113167717 ATTTTTAAACTAAAGGAACAAGG - Intergenic
1013784184 6:113760804-113760826 AAGTTTAAACTAATGGAACAGGG + Intergenic
1014615486 6:123593043-123593065 ATGTTTAATTAGAAGTAACATGG - Intronic
1015748893 6:136540238-136540260 ATTTATAGACAGAAGAAACAAGG + Intronic
1016461206 6:144282003-144282025 TTCTTTAAACAGTAGAAACAGGG - Intergenic
1017238945 6:152146200-152146222 AAGTTTAAACAGAAAGTACATGG + Intronic
1017409176 6:154150708-154150730 ATCTTGACAGAGAAGGAACAAGG - Intronic
1017485898 6:154901469-154901491 ATATTTGAACAAAATGAACAAGG + Intronic
1017831805 6:158137267-158137289 TTGTTTAAAAAAAAAGAACAGGG + Intronic
1018128875 6:160709040-160709062 ATTGTTAACCAGAAGGAACATGG + Intronic
1018387210 6:163315676-163315698 ATGTTTAAAAAAAAAAAACAAGG + Intergenic
1018621791 6:165735738-165735760 ATATTTAAACAGAATGAGTACGG - Intronic
1018655960 6:166036281-166036303 AAAATTAAACAGAAGGAACATGG - Intergenic
1020580992 7:10001628-10001650 ATTATTAAAAAGAAGGTACAGGG + Intergenic
1020685386 7:11287361-11287383 ATGATTAGAGAGAAGGAAGAGGG - Intergenic
1020695632 7:11410367-11410389 ATGTGTAGACAGAAGACACATGG + Intronic
1021454354 7:20813280-20813302 TTGTATAAACAGGAGGAATATGG + Intergenic
1021906865 7:25343247-25343269 ATTTTAAATCAGAAGGAACTAGG + Intergenic
1022431846 7:30331818-30331840 ATGTTAACACAAATGGAACACGG - Intronic
1023747455 7:43334539-43334561 TTGCTTAGAGAGAAGGAACAAGG - Intronic
1023753766 7:43396793-43396815 ATCTGTAAAAAGAAGGAAAATGG - Exonic
1023935703 7:44738299-44738321 GTGTTTATACAGATGGAACTGGG - Intergenic
1024409349 7:49021836-49021858 ATTTTTAAAGAGAAGGATAAAGG + Intergenic
1024525408 7:50344414-50344436 ATGTGTGAAGAGAAGGAACCTGG - Intronic
1027804638 7:82801581-82801603 ATTTCTAAACAGAGGGAAGATGG - Exonic
1027994598 7:85409568-85409590 ATGTTTAAGGTGAAGGGACATGG - Intergenic
1028496414 7:91465884-91465906 AATTTTAAACAGCAGGAAAAGGG - Intergenic
1029179572 7:98690281-98690303 AAGTTTAAAAAAAAGAAACAGGG - Intergenic
1030191149 7:106811582-106811604 ATCTTTAAAGAGAGAGAACATGG - Intergenic
1030619880 7:111777371-111777393 ATATTATAACAGAAGGAACCTGG + Intronic
1031077017 7:117222733-117222755 AGTTTCAAACAGAAGGAATAAGG + Intronic
1031106823 7:117554108-117554130 AGTTTTAAACAGAAGTAACAGGG + Intronic
1031349373 7:120710259-120710281 ATGTTTGCACACCAGGAACAAGG + Intronic
1031644448 7:124206561-124206583 ATGTATACAGAGAAGGAACAAGG - Intergenic
1032242170 7:130171470-130171492 ATGTTTACACTGTAAGAACAAGG + Intronic
1032690322 7:134279663-134279685 ATGTTTAAATAGGATGATCAGGG - Intergenic
1033619832 7:143052232-143052254 AACTTGAAACAGAAGAAACAGGG - Intergenic
1033800719 7:144898905-144898927 ATCTTTAAACAGAAGAAAGTGGG - Intergenic
1035032161 7:155868442-155868464 CTGTTTAGCCAGAAGGAAGAGGG + Intergenic
1035721170 8:1794128-1794150 ATATTTAAACAGAATCAACATGG - Intergenic
1036284920 8:7435854-7435876 ATGATTAAATAGAAAGAACCCGG - Intergenic
1036336555 8:7875676-7875698 ATGATTAAATAGAAAGAACCCGG + Intergenic
1037712008 8:21362335-21362357 ATGTTCCAAGAGAAGGAAGAGGG - Intergenic
1037864196 8:22430017-22430039 ATGTGTAAACAGCAGAAACAAGG + Intronic
1037914412 8:22764070-22764092 ATGATTTCACATAAGGAACATGG - Intronic
1038050569 8:23806516-23806538 ATATTTAAACATATGGTACATGG + Intergenic
1038628003 8:29212914-29212936 ATGTATAATCAGATGGCACATGG + Intronic
1039407712 8:37327230-37327252 AGTTGTAAACAGATGGAACAAGG - Intergenic
1039585935 8:38706985-38707007 ATTTTTAAACAGAAGGCAAGGGG + Intergenic
1039827164 8:41184370-41184392 GTTTTTAAACACAAGGGACAGGG + Intergenic
1039904615 8:41776988-41777010 AGGATTAAACAGAAAGAAAATGG - Intronic
1041488403 8:58404899-58404921 ATGTTTTAAAGGATGGAACAAGG + Intergenic
1043722848 8:83568598-83568620 ATGTATAAACAAAAGGGAAATGG + Intergenic
1043814446 8:84784772-84784794 ATGTTTAGACAGAAGGCAAAAGG + Intronic
1045200534 8:99975887-99975909 CTGATTAAAAAGAATGAACATGG + Intronic
1045377597 8:101590674-101590696 AGGTATAAAGAGAAGGAACATGG - Intronic
1045558508 8:103238058-103238080 ATGGTTTAACAGACAGAACATGG - Intergenic
1045934765 8:107666396-107666418 AATTTTAAACAAAAGGAAAATGG - Intergenic
1046077377 8:109329456-109329478 ATCTTAAAACAGAAGAAAAAAGG + Intronic
1046290156 8:112148717-112148739 ATATTTAAACAGAGGAAACTGGG - Intergenic
1046468897 8:114642270-114642292 ATGTTTGAAAAGAATGAATAAGG + Intergenic
1046489555 8:114932303-114932325 ATGTTGAAACAGAAAGAGGAGGG - Intergenic
1046499844 8:115061393-115061415 ATCTTTAGACTGAATGAACAGGG + Intergenic
1047849553 8:128841859-128841881 ATTTTTAAAAAAAAAGAACAAGG + Intergenic
1047994134 8:130317405-130317427 TTGTTGAAACTGTAGGAACAGGG + Intronic
1048528807 8:135228623-135228645 ATGTTGAAACTGAAGGCTCATGG - Intergenic
1049511765 8:143030808-143030830 ATCTTTAGCCAGAAGGAAAATGG + Intergenic
1050875150 9:10624399-10624421 ATGTTAAAACAAAGGAAACAGGG + Intergenic
1051871371 9:21741404-21741426 ATGCTGAATCAGAAGCAACATGG - Intergenic
1053908631 9:42872313-42872335 ATGTTAAAATAGAAGGTTCAAGG + Intergenic
1055195915 9:73593365-73593387 ATTTTTCAACAGAATAAACAGGG - Intergenic
1055720695 9:79170585-79170607 ATGTTCACACAGAAGCAACTAGG + Intergenic
1056818313 9:89817661-89817683 ATGTGGAAACAGAAGGAAGGAGG + Intergenic
1058285881 9:103177383-103177405 ATGTTTAAACCTAATGAAGAAGG - Intergenic
1058738072 9:107914558-107914580 ATTTTTAAAAATAAGGAACACGG - Intergenic
1059013088 9:110484127-110484149 ATGGCTAAATAGAAGGACCATGG + Intronic
1060001674 9:119964359-119964381 ATGTTAAGACAGCAGGAAAATGG - Intergenic
1060832816 9:126728458-126728480 AATTTTAAAGAGGAGGAACAAGG - Intergenic
1185540671 X:900786-900808 TTATTTAAATAGAAGGAAGAAGG - Intergenic
1186361643 X:8848568-8848590 ATGCTGTAACAGAATGAACAGGG - Intergenic
1186608417 X:11114699-11114721 AGATTTAAACAGAAGAAACCTGG + Intronic
1187228559 X:17398343-17398365 ATCTTTAAACAAGAGAAACAAGG - Intronic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1187924741 X:24239324-24239346 GTGTTTAAGTAGAAGGAAGAAGG + Intergenic
1188004935 X:25010746-25010768 ATTTTTAAAAAGAAGGCAGAAGG - Intronic
1188568046 X:31548860-31548882 TTGTTTAAATAGAAGGACTAGGG + Intronic
1190552024 X:51593772-51593794 ATTTTTAGACTGAAGGAGCATGG - Intergenic
1193534556 X:82697038-82697060 ATTTTTAAAAATATGGAACACGG - Intergenic
1194654215 X:96551833-96551855 ATATTTAAAGAGAAAGGACAAGG + Intergenic
1194976128 X:100397937-100397959 AGGTTGAAAAAGAAGGAAAATGG - Intronic
1195271347 X:103234114-103234136 ATTATTAAATAAAAGGAACAAGG + Intergenic
1195540617 X:106058683-106058705 ATGGTGAGACAGAAGGCACAGGG + Intergenic
1196458759 X:115908397-115908419 ATGTTCAAAGAGAAGGGACATGG + Intergenic
1197572917 X:128171467-128171489 ATATTTTACCAGAAGAAACAGGG + Intergenic
1199744199 X:150761618-150761640 ATGTGTAAACAGCAGCCACAGGG - Intronic
1200052160 X:153439647-153439669 ATGTTAAAACTGAATCAACAAGG + Intergenic
1201849601 Y:18463348-18463370 ATGTTTCAAATGATGGAACAAGG - Intergenic
1201883717 Y:18857027-18857049 ATGTTTCAAATGATGGAACAAGG + Intergenic
1202350466 Y:23984975-23984997 ATGTTGCAACTGATGGAACAAGG + Intergenic
1202520313 Y:25685146-25685168 ATGTTGCAACTGATGGAACAAGG - Intergenic