ID: 964288692

View in Genome Browser
Species Human (GRCh38)
Location 3:155151143-155151165
Sequence CTGTCTAAACATACACAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 155}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964288692 Original CRISPR CTGTCTAAACATACACAGCA AGG (reversed) Intronic
901724582 1:11230852-11230874 CTTTCTAAACACAACCAGCAAGG + Intronic
903914830 1:26756109-26756131 ATGTCCAAAGATACACACCAAGG + Intronic
904217940 1:28939085-28939107 CTGTAACAACATACAGAGCAAGG - Intronic
909549718 1:76884188-76884210 CTGTCTGCACAGACACAGGAGGG - Intronic
909637442 1:77832754-77832776 TTGTCTAAAGGTACAAAGCAAGG - Intronic
910986561 1:93010921-93010943 AAGTGTAACCATACACAGCATGG - Intergenic
913091896 1:115481847-115481869 CTCTCTAGGGATACACAGCAGGG + Intergenic
918075692 1:181169767-181169789 CTGTCTAAACATCATCAGGAGGG - Intergenic
918899167 1:190390376-190390398 CTATCTAAGCATTCACACCATGG - Intronic
919718275 1:200803229-200803251 CTGTCCAAGGTTACACAGCAAGG - Intronic
920957742 1:210634431-210634453 CTGTTGAATCATGCACAGCAGGG + Intronic
922298686 1:224275455-224275477 CATACTAAACATACACAGAAAGG + Exonic
923245375 1:232125887-232125909 CTGTCAAAAAAGACACAGAAGGG - Intergenic
924672444 1:246143291-246143313 CTGTTTAAACTTACAAAGAAAGG - Intronic
1063993897 10:11598081-11598103 CAGTCAAAATATACTCAGCAGGG - Intronic
1065598557 10:27344630-27344652 GTGTCTAAACATAGACAGGAGGG + Intergenic
1067319870 10:45207800-45207822 GTGACTAAACATAGACAGGACGG + Intergenic
1070675289 10:78407718-78407740 CTGTCTTGACATCCACAGGAAGG - Intergenic
1072021390 10:91406888-91406910 TTCTGTAAAGATACACAGCAAGG + Intergenic
1074381991 10:112988676-112988698 CTCTCTTAACATGCACATCACGG - Intronic
1077793238 11:5463789-5463811 CTGTCTAAAGAGATACAGGAGGG + Intronic
1081052901 11:38367379-38367401 CTGACTAAAAATCCACAGCTAGG - Intergenic
1081089391 11:38844531-38844553 CTCTCTAAACAGAGAGAGCAGGG - Intergenic
1081631411 11:44692537-44692559 CTGGCAAAACAGGCACAGCAGGG - Intergenic
1084017565 11:66394646-66394668 CTATTGATACATACACAGCATGG + Intergenic
1085718502 11:78893355-78893377 CTCTCTAAGCATCCACAGAAGGG + Intronic
1087696563 11:101384067-101384089 CTGTATAATCATACACAATAAGG - Intergenic
1087879347 11:103396758-103396780 CTGTATACACACACACAGCATGG + Intronic
1090039272 11:123276125-123276147 GTGTCAAAACACACACAGCCAGG + Intergenic
1091076359 11:132621478-132621500 CTATTAAAACACACACAGCATGG + Intronic
1091362487 11:134988664-134988686 CTGTCCAAACAGACACATCCAGG + Intergenic
1093620219 12:21279137-21279159 CTGTTTGAAAATACACAGTAAGG + Intronic
1098167470 12:67713180-67713202 GTGTTTAAACAAAAACAGCAAGG + Intergenic
1100341903 12:93687297-93687319 CGGTCTATACATCCACAGAAGGG - Intronic
1100989254 12:100234516-100234538 CTTGCTAAACTGACACAGCAGGG + Intronic
1101300591 12:103476065-103476087 CTTTCTGAAAACACACAGCAAGG - Intronic
1105295961 13:19088131-19088153 CTGTCTACACATATGCAGCCAGG - Intergenic
1105760904 13:23513633-23513655 CTGTCTAGAAATACAGAGGAGGG + Intergenic
1107742135 13:43461951-43461973 CTGGATAAACATACAAAGCTTGG + Intronic
1109470888 13:62802115-62802137 CTGTTTAAGGAAACACAGCACGG - Intergenic
1109488400 13:63059090-63059112 CTATATACACATACACAGGAGGG + Intergenic
1109766964 13:66913577-66913599 TGGTCTAAACTTACACAGTACGG - Intronic
1110727935 13:78847645-78847667 TTGTCTAAAAATATACAGCAAGG - Intergenic
1111693480 13:91593360-91593382 CTGACTAGACATACCCAGGAAGG - Intronic
1116224921 14:42137952-42137974 CTGTCTCAACAGACAGAACAAGG + Intergenic
1119705772 14:76781790-76781812 CTGTGTAAACATGCCCAGGAGGG - Exonic
1121521146 14:94587062-94587084 CTGTCTACCCATCCACATCAAGG - Intronic
1122106033 14:99455712-99455734 CTGTATATAAATACAAAGCAGGG + Intronic
1124228857 15:27923172-27923194 ATGTATAAACATATACACCATGG - Intronic
1124898729 15:33802336-33802358 CTGTCAAAATCTACAAAGCAAGG - Intronic
1128675382 15:69604651-69604673 CTCACTAAACATTCACAGAATGG - Intergenic
1129960916 15:79682877-79682899 ATGTCTGAACAGACTCAGCAGGG - Intergenic
1133406142 16:5526060-5526082 CTGTCTACACATGCACTGCCTGG - Intergenic
1135221919 16:20621413-20621435 CTGTCTAAACATACCCACACAGG + Intronic
1135506229 16:23039034-23039056 CTGTCTAAAAATACATATGAGGG - Intergenic
1136129810 16:28212375-28212397 CTGTCCTAGCATCCACAGCAGGG - Intergenic
1137001188 16:35232553-35232575 CTGGCCAACCAGACACAGCAAGG - Intergenic
1139116451 16:63960062-63960084 GTGTCTGAATATACACAGCATGG + Intergenic
1142508890 17:382102-382124 TTGTCCAAAGACACACAGCAAGG - Intronic
1144232047 17:13217339-13217361 CTCTCTAAGCTGACACAGCAAGG - Intergenic
1148926855 17:51094342-51094364 CTGACAAAACAGACAAAGCAGGG + Intronic
1150832206 17:68533629-68533651 CCATCTAAACATACACTGCCAGG - Intronic
1151430326 17:74058010-74058032 CTGTGTAAACACACACACCTGGG - Intergenic
1151976613 17:77487214-77487236 CTGTGTAAACCCACACAGCCGGG - Intronic
1153595424 18:6720417-6720439 CTGTCTTATCATTAACAGCAGGG + Intergenic
1153998025 18:10458796-10458818 CGGTTGAAAGATACACAGCAAGG + Intronic
1156784688 18:40896079-40896101 CTGTATAAACATACACATGCAGG + Intergenic
1156942413 18:42784879-42784901 GTGTCTAATGATACATAGCAAGG - Intronic
1160367483 18:78339956-78339978 TTTTGTATACATACACAGCAGGG + Intergenic
1165197834 19:34119267-34119289 CTGTCTACAATTACACATCAAGG + Intergenic
1166958006 19:46478699-46478721 CTCACTGAACATACACAGCAGGG - Intergenic
925583753 2:5441724-5441746 GTTTCTTAACGTACACAGCATGG - Intergenic
927431658 2:23031468-23031490 CTGTCTAAATGTCCAGAGCAGGG - Intergenic
927436023 2:23067180-23067202 ATGTCTAAAAATACCCAGCGTGG - Intergenic
928335831 2:30397417-30397439 CCATCTAAACATCCACAGTAAGG - Intergenic
931623731 2:64236428-64236450 CTGTCTAAAAAAAAAAAGCATGG + Intergenic
933438860 2:82283808-82283830 CTGTGATAACAGACACAGCACGG + Intergenic
934520541 2:95017594-95017616 TTGTCTAAAGTTGCACAGCAAGG + Intergenic
935991752 2:108725243-108725265 TTGTTTAAAGATACACAGCTAGG - Intronic
937222074 2:120347432-120347454 CTGTCTAAATATAAAAATCAGGG + Intronic
939871949 2:147535509-147535531 CTCTCTCAGGATACACAGCAAGG + Intergenic
940606312 2:155927474-155927496 CTCTCTAAACATTTACACCAAGG + Intergenic
945220143 2:207475053-207475075 TTGTCTACACAAACACAGAATGG - Intergenic
945931983 2:215864458-215864480 CTGTCTAAAAAAAAAAAGCAAGG - Intergenic
946511626 2:220364022-220364044 CTGGATATACATACACACCATGG + Intergenic
948169563 2:235890087-235890109 TTCTCTCAACCTACACAGCATGG - Intronic
1168908436 20:1425629-1425651 CTGTAAATAAATACACAGCAAGG - Intergenic
1175025337 20:55895852-55895874 CTGTCTAAACCCTTACAGCATGG + Intergenic
1179005958 21:37515012-37515034 CATTGTAAACATAAACAGCATGG + Intronic
1184616990 22:45645241-45645263 CGGTCTAAACATACACACTTTGG - Intergenic
949737000 3:7184970-7184992 ATGTGTAAAAATACTCAGCATGG - Intronic
950187962 3:10957072-10957094 CTGTCTACACATCCACAAGACGG - Intergenic
952883143 3:37997919-37997941 CTGCCTAAAGCTCCACAGCAAGG + Intronic
953882648 3:46699451-46699473 CTGACTGAACTTAAACAGCAGGG - Intergenic
954381264 3:50220513-50220535 CTGTAGGAACATACACAGCTGGG + Exonic
957587980 3:82157505-82157527 CTTTACAAACATACACAGCATGG + Intergenic
958069711 3:88594243-88594265 CTGTCTAATCATTCATAGCTTGG - Intergenic
959902274 3:111674495-111674517 CTGTCTACACACACACTGGAAGG + Intergenic
964275129 3:155001380-155001402 CTTGCTAAACAGACTCAGCAGGG - Intergenic
964288692 3:155151143-155151165 CTGTCTAAACATACACAGCAAGG - Intronic
964298206 3:155257613-155257635 CTGTCTCAGCAGACACAGCTAGG - Intergenic
964958488 3:162392835-162392857 ATGTCTAATGATACACAGCCAGG + Intergenic
965869533 3:173249530-173249552 CTGTCTATAGCTACATAGCAAGG - Intergenic
966270833 3:178103449-178103471 CTATATTTACATACACAGCAAGG + Intergenic
966700238 3:182841404-182841426 CTGTCGACAAATACACAGTAAGG - Intronic
967926311 3:194651341-194651363 ATGTCTCAACAAACACAGCATGG - Intronic
970503502 4:16703017-16703039 GTGTATAGACATACACAGGAAGG - Intronic
971797385 4:31245035-31245057 CTCTCTAAACAGACAAAGCAAGG + Intergenic
971837598 4:31788241-31788263 GTGTCTAAATATATACAGCAAGG + Intergenic
972321107 4:37974560-37974582 CTGTCTCAAAAAAAACAGCATGG - Intronic
972516983 4:39818236-39818258 CTCTCTACACATACACAGCTTGG - Intergenic
975454885 4:74578400-74578422 CTTTCAAAACATACACAGAAAGG + Intergenic
979138158 4:117136681-117136703 CTGTTTGAAAATACACAGCCAGG + Intergenic
979834764 4:125351032-125351054 CTGTCTAATGATGCAAAGCATGG - Intronic
979890414 4:126085247-126085269 CAGCCTAAACATACACACAAAGG - Intergenic
985788285 5:1911326-1911348 CTGTCTAAACAGCCTGAGCAGGG - Intergenic
986326146 5:6676182-6676204 ATGTCTAAGCATGCACAGTAAGG + Intergenic
994317602 5:98350104-98350126 CTCTCCAAACAGACAAAGCAAGG + Intergenic
994870548 5:105343846-105343868 CTGTCTCAAAATTCAAAGCAGGG + Intergenic
995530573 5:113088001-113088023 ATGTGTGCACATACACAGCAAGG - Intronic
996663612 5:126032298-126032320 CTTTCTAAACATCCACAAAAGGG + Intergenic
999050871 5:148522784-148522806 CTGGCTAAACAAACCTAGCAGGG + Intronic
999466679 5:151813306-151813328 CTTTCAAAACAAACATAGCAGGG - Intergenic
1000321042 5:160134526-160134548 CTGTCCAAAGTCACACAGCAAGG - Intergenic
1001621441 5:173088877-173088899 CTGTTAAAACATACACAGACAGG + Intronic
1001797768 5:174516191-174516213 CTATCTATACATATACAACAGGG - Intergenic
1010853526 6:80808416-80808438 CTGTCTTAGCAGACAGAGCAAGG - Intergenic
1013117271 6:107113150-107113172 CTGTCTAAAAAAAAAAAGCACGG + Intronic
1014898068 6:126928206-126928228 CCGTCAATACATACACAGCTTGG + Intergenic
1016684858 6:146869653-146869675 CTGTATAAACATACACAGTGTGG - Intergenic
1019273529 7:164005-164027 CTGTCCAGACACACAAAGCAAGG + Intergenic
1019302442 7:313651-313673 CTATCTTAACATAAATAGCACGG + Intergenic
1022870817 7:34477666-34477688 CTGAATAAACATCCACAGCAGGG + Intergenic
1023206756 7:37759098-37759120 TTGCCTAACCATACACAGCAAGG - Intronic
1023833711 7:44056462-44056484 CTGTCTATTGATACACAGCAGGG + Intronic
1031391443 7:121219726-121219748 CATTCCAAACATAAACAGCAAGG + Intronic
1032099960 7:128967102-128967124 ATGTACATACATACACAGCATGG + Intronic
1032528105 7:132595265-132595287 CTGTTTAAAGATAGACAACAAGG - Intronic
1033521504 7:142165678-142165700 TAGTCAAAACATTCACAGCATGG + Intronic
1034330100 7:150275225-150275247 GTATCGAAACAGACACAGCATGG + Intronic
1034667956 7:152834635-152834657 GTATCGAAACAGACACAGCATGG - Intronic
1038163386 8:25061674-25061696 CTGGCTAAACTCATACAGCAGGG + Intergenic
1041679844 8:60577484-60577506 CTGTCTTAGTGTACACAGCAAGG - Intronic
1043099004 8:76016155-76016177 CAGTCAGAACACACACAGCATGG - Intergenic
1043299675 8:78711734-78711756 ATGTCAAATTATACACAGCAGGG - Intronic
1044232245 8:89792774-89792796 CTGTCTTAAAATGCACTGCAAGG - Intergenic
1044418931 8:91968781-91968803 CTGGCTAAAGTTACACAGCTAGG - Intronic
1046530093 8:115434116-115434138 ATGTATATACATACACACCAAGG - Intronic
1046731754 8:117733599-117733621 CTGTCTAAAGTCACACAGCTTGG - Intergenic
1050347451 9:4705722-4705744 CTGTTTAATCATACAAGGCAAGG - Intronic
1053904836 9:42831007-42831029 CACTCTAAACATAAAAAGCAAGG - Intergenic
1054530150 9:66174510-66174532 CACTCTAAACATAAAAAGCAAGG + Intergenic
1055416348 9:76088082-76088104 CTGTCTAAACATCCTCAGACTGG - Intronic
1055617321 9:78086162-78086184 CTGTCTTAATATTGACAGCAGGG - Intergenic
1056011298 9:82333480-82333502 CTGTTTAAATATTCCCAGCATGG + Intergenic
1057093315 9:92280770-92280792 CTGGATTAACACACACAGCAAGG + Exonic
1057263836 9:93601239-93601261 CTGTCTGCACATATACAGCCAGG + Intronic
1058984400 9:110197808-110197830 CTGTGTAAACACAGACAGAAGGG + Intronic
1059653031 9:116333253-116333275 CTTGCTTCACATACACAGCAAGG + Intronic
1186414396 X:9370593-9370615 CTGTCTCAGCACCCACAGCAGGG + Intergenic
1186477887 X:9872672-9872694 ATATCTTAACATACACGGCATGG + Intronic
1186550253 X:10497374-10497396 CTGGCTAAACCAACTCAGCAGGG - Intronic
1186992824 X:15087923-15087945 TTGTATAAACAAACACAGCTGGG - Intergenic
1189779377 X:44499361-44499383 TTCTTTAAAAATACACAGCATGG - Intergenic
1192159331 X:68771214-68771236 CTGACTGACCATACACAGCTGGG - Intergenic
1192699742 X:73455979-73456001 CTTTCCAAAGATACATAGCAAGG + Intergenic
1194595850 X:95856346-95856368 ATTTGGAAACATACACAGCAGGG - Intergenic
1195682856 X:107561785-107561807 CTGATTAAATATTCACAGCAAGG - Intronic
1196885237 X:120238119-120238141 GTGTATAAACATACATAGAATGG - Intergenic
1197261752 X:124327348-124327370 CTATAAAAACATACACAGCAAGG + Intronic
1198041930 X:132861089-132861111 CTGTCGAAAGATACACATGAGGG - Intronic
1200483929 Y:3744157-3744179 GTGTATATACATACACACCATGG - Intergenic