ID: 964297669

View in Genome Browser
Species Human (GRCh38)
Location 3:155251891-155251913
Sequence AGTTATCTGCAGATGATGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964297669_964297673 15 Left 964297669 3:155251891-155251913 CCTCCCATCATCTGCAGATAACT No data
Right 964297673 3:155251929-155251951 AATAGCTCTTTTCCTGTTACTGG No data
964297669_964297674 16 Left 964297669 3:155251891-155251913 CCTCCCATCATCTGCAGATAACT No data
Right 964297674 3:155251930-155251952 ATAGCTCTTTTCCTGTTACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964297669 Original CRISPR AGTTATCTGCAGATGATGGG AGG (reversed) Intergenic
No off target data available for this crispr