ID: 964302202

View in Genome Browser
Species Human (GRCh38)
Location 3:155301038-155301060
Sequence GATGACCCTCAAAATGATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964302202_964302211 23 Left 964302202 3:155301038-155301060 CCAAGATCATTTTGAGGGTCATC No data
Right 964302211 3:155301084-155301106 CATCAGGCCAGGACATAAGGGGG No data
964302202_964302209 21 Left 964302202 3:155301038-155301060 CCAAGATCATTTTGAGGGTCATC No data
Right 964302209 3:155301082-155301104 ATCATCAGGCCAGGACATAAGGG No data
964302202_964302208 20 Left 964302202 3:155301038-155301060 CCAAGATCATTTTGAGGGTCATC No data
Right 964302208 3:155301081-155301103 GATCATCAGGCCAGGACATAAGG No data
964302202_964302207 12 Left 964302202 3:155301038-155301060 CCAAGATCATTTTGAGGGTCATC No data
Right 964302207 3:155301073-155301095 TATCTACTGATCATCAGGCCAGG No data
964302202_964302210 22 Left 964302202 3:155301038-155301060 CCAAGATCATTTTGAGGGTCATC No data
Right 964302210 3:155301083-155301105 TCATCAGGCCAGGACATAAGGGG No data
964302202_964302205 7 Left 964302202 3:155301038-155301060 CCAAGATCATTTTGAGGGTCATC No data
Right 964302205 3:155301068-155301090 GACCATATCTACTGATCATCAGG No data
964302202_964302214 30 Left 964302202 3:155301038-155301060 CCAAGATCATTTTGAGGGTCATC No data
Right 964302214 3:155301091-155301113 CCAGGACATAAGGGGGGATGTGG No data
964302202_964302212 24 Left 964302202 3:155301038-155301060 CCAAGATCATTTTGAGGGTCATC No data
Right 964302212 3:155301085-155301107 ATCAGGCCAGGACATAAGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964302202 Original CRISPR GATGACCCTCAAAATGATCT TGG (reversed) Intergenic
No off target data available for this crispr